ID: 1120794213

View in Genome Browser
Species Human (GRCh38)
Location 14:88614180-88614202
Sequence TTTTATGGGCAGGTTGTTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120794207_1120794213 28 Left 1120794207 14:88614129-88614151 CCAGAGGGAAAATTTAAAACTGC 0: 1
1: 0
2: 3
3: 20
4: 294
Right 1120794213 14:88614180-88614202 TTTTATGGGCAGGTTGTTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 148
1120794206_1120794213 29 Left 1120794206 14:88614128-88614150 CCCAGAGGGAAAATTTAAAACTG 0: 1
1: 0
2: 3
3: 40
4: 362
Right 1120794213 14:88614180-88614202 TTTTATGGGCAGGTTGTTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120794213 Original CRISPR TTTTATGGGCAGGTTGTTCA GGG Exonic
900486666 1:2925925-2925947 TTTTATTGGCAGGGGGTTCAAGG + Intergenic
905636012 1:39552946-39552968 TTTTATTGGTAGCTAGTTCATGG + Intergenic
906653599 1:47532361-47532383 TTTCATAGGCAGGTTTCTCAGGG + Intergenic
906800422 1:48732413-48732435 CTTTATGAGCATCTTGTTCAGGG - Intronic
908716341 1:67074004-67074026 TTTTTGGGGGAGGTTGCTCAAGG - Intergenic
908916866 1:69138242-69138264 TTTTATGGACCAGTGGTTCAGGG + Intergenic
909857449 1:80555054-80555076 TTTTGTGAGCAAGTTCTTCAAGG - Intergenic
911391176 1:97245828-97245850 TTCTATGGCCAGGGTGTCCATGG + Intronic
912205254 1:107501247-107501269 TTTTATGGGCTGTTTGTTCTCGG + Intergenic
914619920 1:149395842-149395864 TTTTGTCAGCAGGGTGTTCAGGG - Intergenic
917170650 1:172169547-172169569 TTTTAAGGGCAATTTGATCAAGG - Intronic
919110807 1:193216905-193216927 TTTGATGGGTAGTTTGTTGAGGG - Intronic
919350752 1:196450965-196450987 TTTTTTAGGTAGGGTGTTCAGGG - Intronic
922386736 1:225093215-225093237 TTTTATGTGCATGTTTGTCAAGG - Intronic
1063587787 10:7368315-7368337 TTCTAGGGCCATGTTGTTCATGG - Intronic
1065506859 10:26438255-26438277 TCTTTTGGGCCGGTTGTGCAAGG - Exonic
1065674555 10:28160547-28160569 TTTTGTGGGGAGGCTCTTCAAGG - Intronic
1067249819 10:44576770-44576792 ATTGCTGGGCAGGGTGTTCATGG + Intergenic
1067647259 10:48120038-48120060 TTTTATTTGCAGGTAGTTAATGG - Intergenic
1068330098 10:55553865-55553887 TTTTATAGTCAGGTTCTTTAAGG - Intronic
1071240132 10:83696160-83696182 TTTCATGGGCAGGTGGTTTGGGG + Intergenic
1072005306 10:91240020-91240042 TTTTATTGGCAGGGTGCTCCAGG - Intronic
1073560249 10:104490090-104490112 CTTTATGGGAAAGTTGTTGAAGG - Intergenic
1075902199 10:126051913-126051935 TTTTAAAGGCAGGCTGGTCAAGG + Intronic
1078913779 11:15758614-15758636 GTTTCTGGTCAGGTTCTTCAAGG - Intergenic
1080528776 11:33153405-33153427 TTTTATTAGGAGGTTGTTAATGG + Intronic
1081079263 11:38719184-38719206 TTTTATTGACAGGTTGTGAAAGG + Intergenic
1085157314 11:74307726-74307748 TTTTATGTGCAGATTCTTGAAGG - Intronic
1085438859 11:76538596-76538618 TTTTGTGGGAAGGTGGGTCAAGG + Intronic
1086046032 11:82533213-82533235 TTTTATGGGGAGGTGGTGTAGGG - Intergenic
1088180812 11:107107771-107107793 TTTTATGGCTAGCTTGTTGAGGG - Intergenic
1089057258 11:115595882-115595904 TCCTATAGGCAGGTTGCTCAGGG + Intergenic
1090401938 11:126454533-126454555 TTTTCTGGGCATGTTGTACCTGG + Intronic
1091092376 11:132784102-132784124 TTTTCTGGGCAGGTTGCTACAGG - Intronic
1094231238 12:28105969-28105991 CTTTGTGGGCAGGTAATTCATGG - Intergenic
1094790591 12:33909422-33909444 TTTTATGACCAGATTGTTTAAGG - Intergenic
1095551860 12:43451628-43451650 TTTTATGGGGAGGTGGGTAAAGG - Intronic
1097788126 12:63783596-63783618 TTCTATCTGCAGGTTATTCAAGG + Intronic
1101654733 12:106709888-106709910 TTTTATGGGCAGGAACTTCAAGG - Intronic
1101908301 12:108844304-108844326 TTTTAAGGCCAGCATGTTCAAGG + Intronic
1102884425 12:116510895-116510917 TATTATGTGCAGGTTATTAAGGG - Intergenic
1105470056 13:20685354-20685376 TTTTATGGCCAGTTTCTTTAAGG + Intronic
1108031449 13:46234288-46234310 TACTATGGCCAGGTTGGTCATGG - Exonic
1108464725 13:50703906-50703928 TTTTAAAGTCAGGTTTTTCAAGG - Intronic
1108587402 13:51882613-51882635 TATTCTTGGCAGGTTTTTCATGG - Intergenic
1109485633 13:63015626-63015648 TTTTATGGGGTGTTTGTTTATGG + Intergenic
1110685084 13:78362950-78362972 TTTTATGGTCTGAATGTTCATGG - Intergenic
1111662111 13:91224450-91224472 TTTTTTGGGGAGGTTTTGCAGGG - Intergenic
1112702973 13:102033078-102033100 GTTTATGGGTAGGGTATTCAAGG - Intronic
1117114375 14:52494658-52494680 TTTTCTTGGCAGGATATTCATGG - Intronic
1119114507 14:72006908-72006930 TTCTATGGACAGTGTGTTCAAGG - Intronic
1120218461 14:81705554-81705576 TTTTATTGGCACGTTTTTTATGG + Intergenic
1120794213 14:88614180-88614202 TTTTATGGGCAGGTTGTTCAGGG + Exonic
1126179459 15:45770409-45770431 TTTTGTGGGCAGGTGGTTTTTGG + Intergenic
1126749031 15:51857332-51857354 TATGCTGGGCAGGGTGTTCATGG + Intronic
1131764090 15:95656515-95656537 TTATATGGGTAGCTTTTTCATGG + Intergenic
1132342979 15:101089830-101089852 TATTAGGGGCAGGCTGTTCTTGG - Intergenic
1133313535 16:4867410-4867432 TTGTATAGGCAGGTTCCTCAGGG + Intronic
1133832988 16:9341411-9341433 CTTTCTGGGCAGGTTGTTTCAGG + Intergenic
1135766780 16:25184645-25184667 TTATATGGTCAGGTTGTGTATGG + Intergenic
1137017264 16:35390529-35390551 TTTTATTTTCAGGTTGGTCATGG - Intergenic
1140950680 16:79814327-79814349 TTCCATGGACAGGATGTTCAGGG - Intergenic
1142850467 17:2702102-2702124 TGTGCTGGGCAGGTTGTTCAGGG - Intronic
1144763160 17:17718692-17718714 TTTTATGAGCATGTTGATCCAGG - Intronic
1149723913 17:58872608-58872630 TTTTGTGGGCTGGTTGCTGAAGG + Intronic
1153321510 18:3778551-3778573 CTGTATAGGCAGGTTTTTCAGGG + Intronic
1155367756 18:25065792-25065814 TGTTATGGGCAGTTTGTTTTGGG - Intronic
1156973259 18:43183958-43183980 TTTTATGGGCAGGGTCTAGAAGG - Intergenic
1157295014 18:46435985-46436007 AATTATGGGCAGATTGCTCAGGG - Intronic
1157821296 18:50772231-50772253 GTTCAAGGGCAGGATGTTCAAGG + Intergenic
1158016848 18:52793079-52793101 TTTTATAGGCAGGTTGGAGAAGG + Intronic
1159658343 18:71059981-71060003 TATATTGGGCAAGTTGTTCAAGG + Intergenic
1164679530 19:30124388-30124410 TTTCCTGGGCAGGTTGGTTAGGG + Intergenic
1165797691 19:38528400-38528422 TTACGTGGGCAGGTTGTACAGGG - Exonic
925488073 2:4358723-4358745 TTTTATGGGCAGGGTAGTCTGGG + Intergenic
926055171 2:9770120-9770142 TTCACTGGGCAGGTTGCTCATGG - Intergenic
928712097 2:34018694-34018716 TTTTACGTGCATGTTGTTTATGG + Intergenic
928983032 2:37156049-37156071 TTGTATAGGCAGGTTGTTTGAGG + Intronic
929321366 2:40547069-40547091 TTTCATGGGCAGCTTTCTCAAGG - Intronic
930168073 2:48222811-48222833 TTTTGTGGGAAGGTGGTCCAAGG - Intergenic
931278041 2:60761733-60761755 TTTTATAGGCTGGTGGTTCTTGG + Exonic
932134685 2:69217994-69218016 TCTCATGGACAGGTTCTTCAGGG + Intronic
933448373 2:82412538-82412560 TTTTATGTGCAGGATGTTCTTGG - Intergenic
934038759 2:88110433-88110455 CTGCATGGGCTGGTTGTTCAGGG - Exonic
935202065 2:100865866-100865888 TTTTAGCGGGAGGTAGTTCAAGG - Intronic
937621617 2:123994588-123994610 TCTTATTGGCATGTGGTTCACGG - Intergenic
938146699 2:128840330-128840352 TTTTATGGGTAGGTTTTTGAGGG + Intergenic
938887204 2:135663059-135663081 TTTTATAGGCAGTTTGACCATGG - Intronic
939520828 2:143228277-143228299 TTTTATGGGAAGGATGCACATGG + Intronic
940112160 2:150166916-150166938 TTTTATAAGAAGGGTGTTCATGG - Intergenic
941307433 2:163888701-163888723 CTGTCTGAGCAGGTTGTTCATGG + Intergenic
1169367696 20:5004160-5004182 TATTCAGGGCAGGTTGTTCAAGG - Intronic
1169837897 20:9900855-9900877 ATTTATGGGTAGGTTGATCTTGG - Intergenic
1170027193 20:11902000-11902022 CTTTATGCTCAAGTTGTTCAAGG - Intronic
1170905184 20:20508869-20508891 TTTTAAGTGAAGGTTGATCAAGG + Intronic
1171156682 20:22880834-22880856 TTTTGTGAGCAGGTCATTCATGG + Intergenic
1177067108 21:16453311-16453333 TTTCATAGGCAAGGTGTTCATGG + Intergenic
1179389747 21:40976995-40977017 TTTTATGGGGATGGAGTTCAAGG - Intergenic
1183412653 22:37664420-37664442 TTTTATGAGCTGGTTGTTAAAGG - Intronic
1183680286 22:39324538-39324560 ATTTATGGGCAGGGTCATCAGGG + Intergenic
951452796 3:22858372-22858394 TTTGATGTGCAGGTTGTAGATGG - Intergenic
952163095 3:30715743-30715765 TTTTATGCTCAGGTGGTTCCAGG - Intergenic
953200624 3:40775453-40775475 TCTTATGTGCAGGTTATTGAAGG + Intergenic
955654959 3:61235467-61235489 TTTTATGTGCAGATAGATCATGG + Intronic
958425832 3:93977904-93977926 ATTTATGGGCAGGTCTTTCATGG - Intergenic
959670511 3:108971902-108971924 TTTCCTGGACTGGTTGTTCATGG - Intronic
960050986 3:113239435-113239457 TTGTATAAGCAGGTTGTTAATGG + Intronic
964408738 3:156377091-156377113 TTTTAAGGGCAGCTGGATCATGG + Intronic
965396621 3:168166877-168166899 TTGGTTGGGCAGATTGTTCACGG - Intergenic
973115122 4:46447867-46447889 TTTTATGGGGATATTATTCAAGG - Intronic
973899120 4:55449075-55449097 TTTTATTGAGAGCTTGTTCAAGG - Intronic
978280360 4:107004721-107004743 TTGTATGGGAAGGTTATTCTGGG + Intronic
980145938 4:128984086-128984108 TATTATGGCAAAGTTGTTCATGG + Intronic
980467516 4:133204456-133204478 TTTTATGGGCAGGAGACTCAGGG + Intronic
980819862 4:138000073-138000095 TTTTCTGGGAAGATTCTTCAAGG + Intergenic
981199609 4:141965546-141965568 TTTTATGATCTGGTTGTGCAGGG - Intergenic
985344936 4:188994292-188994314 TTTGGTGGGGACGTTGTTCATGG + Intergenic
988422273 5:31020843-31020865 TTTTATGTGCAAGTATTTCAAGG - Intergenic
990757085 5:59085511-59085533 TATTATATCCAGGTTGTTCATGG + Intronic
992486017 5:77196429-77196451 TTTTATGGTTAGTTTGTACATGG + Intergenic
996042521 5:118831801-118831823 CTTTATGGTCACTTTGTTCATGG - Intergenic
1000177826 5:158775313-158775335 TTTTATGGCCAGGTGGCTCTAGG + Intronic
1003699462 6:8446093-8446115 TTTTAAGGTCAGTTTGTTCCGGG + Intergenic
1004174670 6:13329016-13329038 TTTTCTGGGCAGGTTGCTGCAGG + Intergenic
1005767360 6:29025736-29025758 TTATATGGTCAGGGTTTTCAAGG + Intergenic
1011228198 6:85130928-85130950 TTTTATGGTTATGTGGTTCATGG - Intergenic
1020207553 7:6130732-6130754 TTTTATGAGATGGTTGCTCAGGG + Intronic
1022217691 7:28280635-28280657 TATTTTGAGCAGGTGGTTCAGGG - Intergenic
1022273153 7:28830026-28830048 TTTTTTGGGGAGGTTGGTGATGG + Intergenic
1022555633 7:31292437-31292459 GTTTAGGGGCAGATTGTGCAGGG + Intergenic
1025502419 7:61321398-61321420 ATTCAGGAGCAGGTTGTTCAGGG - Intergenic
1025517287 7:61667620-61667642 ATTCAGGAGCAGGTTGTTCAGGG - Intergenic
1025520930 7:61729086-61729108 ATTCAGGAGCAGGTTGTTCAGGG - Intergenic
1025541612 7:62096272-62096294 ATTCAGGAGCAGGTTGTTCAGGG - Intergenic
1025545284 7:62158647-62158669 ATTCAGGAGCAGGTTGTTCAGGG - Intergenic
1026286992 7:68972006-68972028 TATTATGGGCACGGTGGTCATGG + Intergenic
1028326750 7:89536926-89536948 TTGTATCACCAGGTTGTTCAAGG + Intergenic
1028811566 7:95093616-95093638 TTTGATGGGTAGGTTTTTCCTGG - Intronic
1033630968 7:143157448-143157470 TTTTAATGATAGGTTGTTCAAGG + Intergenic
1033952225 7:146798738-146798760 TTTTATGGGCAGATTTTTTTTGG + Intronic
1036487530 8:9193082-9193104 TTTCATGGGTAAGTTGTTCATGG + Intergenic
1038361705 8:26886011-26886033 TTTTTATGGCAGGTTGTTAACGG + Intergenic
1039267145 8:35838115-35838137 TTTAGTGGGGAGGTTGCTCATGG + Intergenic
1041103917 8:54423269-54423291 ATTTATGGTCAGGTGATTCATGG + Intergenic
1042606950 8:70555051-70555073 TTATATGGGCAGAGTCTTCATGG + Intergenic
1042664744 8:71192711-71192733 TTTTGTGGGCTGGTTGGACAGGG - Intergenic
1043251828 8:78084378-78084400 TTTTAGTGTTAGGTTGTTCATGG + Intergenic
1050791729 9:9480084-9480106 TTTTGTGGGCAGTATTTTCATGG - Intronic
1050941701 9:11468850-11468872 TCTTAAATGCAGGTTGTTCATGG + Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1060247248 9:121957246-121957268 CTTTATGGGCAGGCTGTTTCTGG - Intronic
1187751891 X:22475404-22475426 TATAATGGGCATATTGTTCAAGG + Intergenic
1188544838 X:31293696-31293718 TTTTAAGACAAGGTTGTTCAGGG + Intronic
1192805069 X:74501497-74501519 TTTCATGGGGAGGTTGTAGAAGG + Intronic
1194317945 X:92405266-92405288 TATTATGGGGAGGGAGTTCATGG - Intronic
1194411379 X:93562743-93562765 TTTTATGGTCATGTTTTTCCTGG - Intergenic
1194536524 X:95111105-95111127 TTGTATATGCAGGTTCTTCAGGG + Intergenic
1196301674 X:114055816-114055838 TTTTAAGGGCTGGTTTTTGAGGG + Intergenic
1200626120 Y:5518562-5518584 TATTATGGGGAGGGAGTTCATGG - Intronic