ID: 1120794251

View in Genome Browser
Species Human (GRCh38)
Location 14:88614785-88614807
Sequence AAGTTTTTACAAATGGAGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 458}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120794246_1120794251 11 Left 1120794246 14:88614751-88614773 CCCTAATCCACTAAAAAAAGGAA 0: 1
1: 0
2: 0
3: 32
4: 460
Right 1120794251 14:88614785-88614807 AAGTTTTTACAAATGGAGTTGGG 0: 1
1: 0
2: 3
3: 43
4: 458
1120794247_1120794251 10 Left 1120794247 14:88614752-88614774 CCTAATCCACTAAAAAAAGGAAT 0: 1
1: 0
2: 0
3: 27
4: 433
Right 1120794251 14:88614785-88614807 AAGTTTTTACAAATGGAGTTGGG 0: 1
1: 0
2: 3
3: 43
4: 458
1120794248_1120794251 4 Left 1120794248 14:88614758-88614780 CCACTAAAAAAAGGAATTCTAAC 0: 1
1: 0
2: 1
3: 30
4: 335
Right 1120794251 14:88614785-88614807 AAGTTTTTACAAATGGAGTTGGG 0: 1
1: 0
2: 3
3: 43
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120794251 Original CRISPR AAGTTTTTACAAATGGAGTT GGG Exonic
901386580 1:8913434-8913456 AAGTTTTTAAAATTTGAGTCAGG + Intergenic
901415866 1:9116048-9116070 AAGTATTTACACATGGAAGTTGG - Intronic
902327143 1:15708592-15708614 AAGTTTTTTAAAATAGAGATGGG + Intronic
903099091 1:21012559-21012581 GAGTTTTTACAAAGGTACTTTGG - Intronic
903121808 1:21221040-21221062 AAGCTTTTCCAACTGGTGTTTGG - Intronic
904648397 1:31985991-31986013 AAGTTTTTAAAAAATGAGCTGGG - Intergenic
904918516 1:33987454-33987476 AAGTTTTAACCCAGGGAGTTGGG + Intronic
905878290 1:41447550-41447572 ATGTTCTTAAAAATGGAGATGGG + Intergenic
905926771 1:41756462-41756484 AAGTTTGTAAAAGTGGAATTTGG - Intronic
906324639 1:44837569-44837591 AATTTTTTAGAAATAGAGATGGG + Intronic
907383965 1:54113791-54113813 ACGATTTTACAAATGCAGGTTGG - Intergenic
907763341 1:57383731-57383753 TAATTTTTGTAAATGGAGTTAGG - Intronic
907881246 1:58550962-58550984 CGCTTGTTACAAATGGAGTTGGG + Intergenic
907907292 1:58794647-58794669 TAGTTTTTAAAAATACAGTTAGG + Intergenic
907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG + Intergenic
907938175 1:59061360-59061382 AAGTTTTAACATATGAATTTTGG - Intergenic
907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG + Intergenic
909166256 1:72229168-72229190 ACTTGTTTACAAATGGAGTTGGG - Intronic
909197052 1:72640493-72640515 AAATTTTTAAAAATTGATTTGGG - Intergenic
909219256 1:72933848-72933870 AATTTTAAACAAATGGTGTTTGG + Intergenic
910014593 1:82506117-82506139 ATGTTTTTATTAATGTAGTTAGG - Intergenic
910619636 1:89238577-89238599 AAGTTTTTCTTAATGAAGTTGGG + Intergenic
911866534 1:103032213-103032235 AAGTTATTAAATATGGAGTCGGG - Intronic
912946202 1:114087076-114087098 AATTTTTTAAAAATAGAGATGGG + Intergenic
913116889 1:115705540-115705562 CAGTTTTCACAAATGAAGTTTGG - Intronic
914932620 1:151948540-151948562 AAATTCTCACAAATGGAGCTGGG + Intergenic
915561061 1:156688356-156688378 ATGTTTTTAAAAATAGAGATAGG + Intergenic
916094272 1:161334614-161334636 TATTTTCTAGAAATGGAGTTTGG + Intronic
916342030 1:163747093-163747115 CAGTTTTTACAAATAGCATTGGG + Intergenic
917286235 1:173424154-173424176 AAGTTTTAACATATGAACTTGGG + Intergenic
918027547 1:180766858-180766880 AACTTTTGTCAAATGGAGTTAGG - Intronic
918440569 1:184562294-184562316 AAATTATAACAAATGGTGTTAGG + Intronic
918630524 1:186712145-186712167 AAGTTTTAACATATGAATTTTGG + Intergenic
918738387 1:188095827-188095849 AAGTTTGGACAAAAGGAGTGTGG - Intergenic
918961780 1:191288009-191288031 AAGTTTATAAAAAGGGAGTCAGG + Intergenic
919468313 1:197948752-197948774 AAGTTTTTAAAAGGGGAGTTGGG - Intergenic
919720549 1:200829380-200829402 AATTTTTTAAAAATAGAGATGGG - Intronic
921667594 1:217891266-217891288 AACTTTGTAAAAATGGTGTTTGG + Intergenic
922360096 1:224813330-224813352 AGGTTTTGACAAATGAATTTGGG - Intergenic
923068070 1:230538395-230538417 AAATTTTAACATATGGATTTGGG + Intergenic
923889100 1:238191528-238191550 AAGTTTTAACATATGAATTTTGG - Intergenic
1063584827 10:7342735-7342757 TATTTTTTAATAATGGAGTTAGG - Intronic
1065576557 10:27126140-27126162 ATGATTTTTAAAATGGAGTTAGG + Intronic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1067710398 10:48646588-48646610 ATTTTTTAACAAATGGTGTTGGG + Intronic
1067838582 10:49657392-49657414 AAGTTTCAACACATGAAGTTTGG + Intronic
1068487918 10:57683071-57683093 AAGTTTGTACTTATGTAGTTGGG + Intergenic
1068955749 10:62817762-62817784 AAGTTTTTAAAAATTGCTTTGGG - Intronic
1068979684 10:63049120-63049142 CAGTCTTAACAAATGGTGTTGGG + Intergenic
1069205792 10:65683701-65683723 AATTTTTTAAAAATTGACTTTGG + Intergenic
1071380255 10:85052396-85052418 ATGTTTTTACAAAGGGAGATTGG + Intergenic
1071874574 10:89830613-89830635 AAGTTTTTAAAAATATATTTTGG + Intergenic
1074329950 10:112496266-112496288 AAGTATTTACATATGAAGGTTGG + Intronic
1078629667 11:12990773-12990795 GAGCTTTTAGAAATAGAGTTAGG + Intergenic
1078861819 11:15255234-15255256 ACTTTTTTTCAAATAGAGTTTGG - Intergenic
1079044752 11:17091417-17091439 ATGTTTTGACATATGGATTTGGG + Exonic
1081766492 11:45614861-45614883 AAGTTTTAAAAAATGCAATTTGG - Intergenic
1082122876 11:48398304-48398326 AAGTTTTAACATATGAATTTTGG + Intergenic
1082556574 11:54569580-54569602 AAGTTTTAACATATGAATTTTGG + Intergenic
1082932896 11:58627536-58627558 TTGTTTTTACAAAATGAGTTAGG - Intergenic
1084870328 11:72094457-72094479 AAGTTTTAAGAAATAAAGTTTGG + Intronic
1085848396 11:80092693-80092715 AAGTTTTATCAAACGCAGTTAGG - Intergenic
1085925766 11:81018747-81018769 AATGTTATACAAATAGAGTTGGG + Intergenic
1085941305 11:81208894-81208916 AAGTTTTTAAAAATTAATTTGGG + Intergenic
1086157058 11:83678943-83678965 AATATTTTAAAAATGAAGTTGGG - Intronic
1087536962 11:99460657-99460679 AAGTTTTTAAAAATCGCTTTAGG - Intronic
1087767305 11:102169600-102169622 AAGTTTTTAAAAAAGGTATTTGG - Intronic
1087814709 11:102645843-102645865 AAGTTGTTAGAAATGTAGATTGG - Intergenic
1088040814 11:105379644-105379666 AAGTTTCAACATATGGATTTTGG - Intergenic
1090499792 11:127250354-127250376 GAGTTTTTAGAAATGGAGAGTGG + Intergenic
1090612515 11:128484116-128484138 AAGTGTTTAAAAATAGAGCTGGG - Intronic
1091113082 11:132988998-132989020 GAATTTTTGCCAATGGAGTTTGG - Intronic
1092321941 12:7485334-7485356 AAGTTTTTTACAATGGAGCTTGG - Exonic
1092829561 12:12430507-12430529 AGGTTTTTACTTATGGAGTAGGG + Intronic
1093325288 12:17767324-17767346 AAGTTTTGACAAATGCATTCTGG + Intergenic
1095368722 12:41440635-41440657 AATTATTTTCAACTGGAGTTGGG + Intronic
1097445397 12:59666044-59666066 ATGATTTTACAATTGGAGTTTGG + Intronic
1097787553 12:63778471-63778493 AAGCTTTTAAAAATGTATTTAGG - Intergenic
1098107735 12:67088115-67088137 AACTTTTTAAAAATGGAATGAGG + Intergenic
1098650942 12:72967723-72967745 AAGTTTATACACATGTAGCTTGG + Intergenic
1099222212 12:79928462-79928484 AGGTTTTTAAAAATGGATTTAGG + Intronic
1099338223 12:81392808-81392830 AAGTTCTCACTAATTGAGTTGGG - Intronic
1099545143 12:83969854-83969876 AATTATTTGCAAATGGGGTTGGG + Intergenic
1099838674 12:87938775-87938797 AACATTATATAAATGGAGTTGGG + Intergenic
1099967127 12:89459768-89459790 AGGTTTTTACAAATAGTATTTGG - Intronic
1100962789 12:99983076-99983098 AAATTTTTACAACTATAGTTGGG + Intronic
1101065056 12:101012292-101012314 AAATTTTTAAAAATAGAGCTGGG - Intronic
1101418849 12:104532421-104532443 AATATTTTAAAAATTGAGTTTGG - Intronic
1101766227 12:107701971-107701993 AAGTCTTAACAAATGGGGCTGGG - Intronic
1104629551 12:130387789-130387811 AAGTTTTAACAAATGTACATGGG + Intergenic
1105043842 12:132985655-132985677 TAGGTTTTACAAAGGCAGTTGGG + Intergenic
1105416366 13:20215760-20215782 AAATAGTAACAAATGGAGTTTGG + Intergenic
1105418621 13:20233346-20233368 AAGTTTTTAAAACTTGACTTGGG - Intergenic
1105720268 13:23106840-23106862 AGTTTTTTAAAAAAGGAGTTTGG - Intergenic
1106068402 13:26381239-26381261 AAGGCTTTCCAAATGGAATTAGG - Intronic
1106117917 13:26832912-26832934 AATTGTTTTGAAATGGAGTTTGG + Intergenic
1106507825 13:30386934-30386956 AGGTTTTTATAAGTGCAGTTGGG - Intergenic
1107063650 13:36188433-36188455 AAGTATTTACAAAGGGACTGAGG - Intronic
1107243753 13:38267773-38267795 AAGATTTAATAAATGGTGTTGGG + Intergenic
1107351289 13:39517698-39517720 AATTTTTTAAAAATTGAGATAGG + Intronic
1107856312 13:44618622-44618644 AACTTTTTAAAAATAGAGATGGG + Intergenic
1108230990 13:48340126-48340148 TAGTTTTTATAAATGGTGTGAGG - Intronic
1108278544 13:48837413-48837435 AAGTATTTACAAACAGAATTCGG - Intergenic
1109063335 13:57649885-57649907 AAGTTTATTCAAGTAGAGTTAGG - Intronic
1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG + Intronic
1110325654 13:74211783-74211805 ATTTTTTAACAAATGCAGTTTGG + Intergenic
1110563200 13:76931251-76931273 CATTTTATACAAATGCAGTTAGG - Intergenic
1111339066 13:86860502-86860524 AAGTTGTTATACATGCAGTTTGG - Intergenic
1111497419 13:89070483-89070505 AGATTTTAACAAATGGATTTAGG - Intergenic
1111587157 13:90296880-90296902 AAATTTTTACTAATATAGTTAGG + Intergenic
1111666149 13:91271540-91271562 AATTTTTTAAAAATGAAGTTAGG + Intergenic
1113516025 13:110899464-110899486 AAGATTTTTCAAATGGATGTAGG - Intronic
1113774769 13:112937471-112937493 AAGTTCTTTGAAAAGGAGTTTGG + Intronic
1114171490 14:20277287-20277309 AAGTTTTAACATATGAAATTCGG + Intronic
1114937702 14:27563992-27564014 CAGTTTTTATAAAATGAGTTTGG - Intergenic
1114985899 14:28228403-28228425 TTCTTTTTACAATTGGAGTTTGG + Intergenic
1116543201 14:46126316-46126338 AAATTTTTATAAATGGAATAAGG - Intergenic
1116704146 14:48275294-48275316 AATTTTTTATAAATGGAATTAGG - Intergenic
1117105199 14:52391239-52391261 CAGTATTAAGAAATGGAGTTGGG + Intergenic
1117514441 14:56486477-56486499 AAGTTCTAACATATGGATTTTGG + Intergenic
1117847162 14:59923506-59923528 TAGTTTTAAAAAATGCAGTTGGG - Intronic
1118676491 14:68190711-68190733 AACTTTTTAAAAATGGAGTCAGG - Intronic
1118935546 14:70284661-70284683 AATTTTTTATAAATAGAGATTGG + Intergenic
1119602952 14:75989550-75989572 AAGTTTTTTCAAATGGACAGAGG - Intronic
1119843280 14:77809338-77809360 AAATTTTTTGAGATGGAGTTTGG + Intronic
1120050358 14:79858889-79858911 TAGTTTTTACAAATGGGATTTGG - Intronic
1120605269 14:86568346-86568368 ATGTTGTTATAAATGTAGTTCGG - Intergenic
1120794251 14:88614785-88614807 AAGTTTTTACAAATGGAGTTGGG + Exonic
1122617984 14:103034209-103034231 ATGTTTTTAAAAATAAAGTTTGG - Intronic
1125547967 15:40522189-40522211 TATTTTTAACAAATGGTGTTGGG - Intergenic
1126597671 15:50398210-50398232 AAATTTTTAGAAATAGAGATGGG - Intergenic
1127683703 15:61321435-61321457 ATGTTTTTAAAAATAGACTTTGG + Intergenic
1129751197 15:78065779-78065801 AAGTTTTAGGAAACGGAGTTGGG + Intronic
1130114872 15:80998015-80998037 AAGTTTTAACATATGAATTTGGG + Intergenic
1130144189 15:81260892-81260914 AATTTTCTAGAAATGGAATTTGG + Intronic
1130384719 15:83401079-83401101 AAGGTTTCACATAAGGAGTTTGG + Intergenic
1131060569 15:89401374-89401396 AAGTTTGGCCAATTGGAGTTGGG - Intergenic
1132014877 15:98306667-98306689 AAGTTTATGCAGATGCAGTTGGG - Intergenic
1136053411 16:27669856-27669878 AAGTTTTTAAAAATAGAGTTGGG + Intronic
1138007521 16:53351727-53351749 AAGTTTTAACACATGAATTTTGG + Intergenic
1139180443 16:64741554-64741576 AAGAGTTTACAAATATAGTTTGG - Intergenic
1139840375 16:69873692-69873714 CAGTGTTTACAAATGGGGATGGG + Intronic
1140226228 16:73079508-73079530 AATTTTTTAAAAATAGAGATGGG + Intergenic
1142587297 17:981251-981273 GTCTTTTCACAAATGGAGTTTGG - Intergenic
1144547316 17:16209547-16209569 AATTTTTTAAAAATAGAGATGGG - Intronic
1145299059 17:21617804-21617826 AACTTTTTAAAAATAGAGATAGG + Intergenic
1145903428 17:28502732-28502754 AAAATTTAATAAATGGAGTTGGG - Intronic
1147552366 17:41452965-41452987 AATTTTTTAAAAATGAAGTTAGG + Intergenic
1147858028 17:43497902-43497924 AATTTTTTACAAATTTATTTTGG + Intronic
1148355980 17:46976230-46976252 AAGTTTTTAAAAAAGAAATTTGG + Intronic
1149237846 17:54613306-54613328 TAGTTTTTACAAATTGGCTTTGG - Intergenic
1149573726 17:57696442-57696464 AAGTTTTTAGAATTAGAGCTGGG + Intergenic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1153961336 18:10142740-10142762 AATTTTTCACAATTGGACTTGGG - Intergenic
1154313469 18:13285084-13285106 TAGTTCTTACAAATGGAGGGAGG + Intronic
1155069389 18:22300510-22300532 CAGTATTTTCAAATGGAATTTGG + Intergenic
1155131097 18:22935132-22935154 AAGTTTTTAAAAGTAGAATTAGG - Intronic
1155214455 18:23630747-23630769 AATTTTTTAAAAATGAGGTTTGG - Intronic
1155557931 18:27042398-27042420 GAGTATTTACACATGGAGATTGG - Intronic
1155572920 18:27215075-27215097 AAGTGTTTACACACGGAGCTAGG - Intergenic
1155685796 18:28548459-28548481 AAGTTTTCAGAACTAGAGTTAGG + Intergenic
1156022860 18:32619797-32619819 GAATTTTTCCAAATGGAGCTGGG + Intergenic
1156145901 18:34177441-34177463 AAGTTTTAACAAATTTATTTAGG - Intronic
1158185036 18:54761908-54761930 AAGTCTTTACAGATGTAATTAGG + Intronic
1158218565 18:55126411-55126433 AGGTTTTTATAAATGGACTCAGG - Intergenic
1158400376 18:57116345-57116367 AAGTTTCAACAGATGGATTTGGG + Intergenic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1159842806 18:73419137-73419159 AAGTTTTCAGAATTGAAGTTAGG + Intergenic
1159884233 18:73888981-73889003 AAGTGTGTACAAATAGTGTTAGG - Intergenic
1160925666 19:1543994-1544016 AACATTTTAGAAATGGAATTAGG + Intergenic
1163868407 19:19795828-19795850 AATTTTTTACAAATGTATTTTGG - Intronic
1163911359 19:20196774-20196796 AATTTTTTACAAATGTATTTTGG + Intronic
1163922346 19:20302715-20302737 AATTTTTTACAAATGTATTTTGG + Intergenic
1163927309 19:20358125-20358147 AAGTTGTTACAAAAAGAGCTAGG + Intergenic
1163946917 19:20546144-20546166 AATTTTTTACAAATGTATTTTGG - Intronic
1163961212 19:20695035-20695057 AATTTGTTACAAATGTATTTTGG + Intronic
1163971848 19:20805637-20805659 AATTTTTTACAAATGTATTTTGG + Intronic
1164020118 19:21294896-21294918 AATTTTTTACAAATGTATTTTGG - Intronic
1164166751 19:22685004-22685026 AATTTTTCACAAATGTAATTTGG + Intergenic
1164215754 19:23145094-23145116 ACTTTTTTACAAATGTACTTTGG + Intronic
1164223854 19:23224505-23224527 AATTTTTCACAAATGTATTTTGG - Intronic
1164287422 19:23831402-23831424 AATTTTTTACAGATGTATTTGGG + Intergenic
1164558934 19:29275309-29275331 AGGATTTTGCAAATGGAGGTAGG - Intergenic
1164979377 19:32602239-32602261 AAATAATTACAAATGGAGCTTGG + Intronic
1165664678 19:37617954-37617976 AAATTTTTATAAATGGTATTGGG + Intronic
1168566185 19:57425870-57425892 AAGTTATTACAAATTCACTTTGG + Intronic
925195345 2:1919392-1919414 AAGTTGTTGCAAAAGGTGTTTGG - Intronic
926642711 2:15254294-15254316 AGGTTTTTTAAAATGCAGTTTGG - Intronic
926666318 2:15527680-15527702 AAGTTTTAATACATGGATTTTGG + Intronic
929243923 2:39681803-39681825 CAGTTTTTACAAAGGGAGAAAGG + Intronic
929347207 2:40899338-40899360 AAGTTTTGACAAATTGTATTGGG + Intergenic
930793558 2:55361072-55361094 AAGTTTTTTGAGATGGAGTCTGG - Intronic
930967309 2:57345382-57345404 ATGTTTTAAAAAGTGGAGTTGGG - Intergenic
931562588 2:63578717-63578739 AAGATTTTAAAAATTAAGTTAGG + Intronic
931596960 2:63957659-63957681 AGGTTTCTACTAATGGATTTGGG - Intronic
932368486 2:71168353-71168375 AAGTTTTAACACATGAATTTTGG - Intergenic
932912580 2:75820563-75820585 AGGTTTTTCCAAATAGAGGTTGG + Intergenic
932918708 2:75884913-75884935 TAATTTTTAAAAATGGAATTAGG + Intergenic
932962714 2:76433188-76433210 TATTTTTTTCAAATGGAATTTGG + Intergenic
935429541 2:102960311-102960333 AAGTTTCAACACATGGATTTTGG + Intergenic
935715403 2:105934854-105934876 TTGTTATTTCAAATGGAGTTTGG - Intergenic
936135197 2:109886830-109886852 CAGTTTTTATTAATAGAGTTCGG - Intergenic
936135209 2:109887016-109887038 AATTTTTTTCATATGGACTTTGG - Intergenic
936209488 2:110484469-110484491 AATTTTTTTCATATGGACTTTGG + Intergenic
936209500 2:110484655-110484677 CAGTTTTTATTAATAGAGTTCGG + Intergenic
936272962 2:111065668-111065690 AGGTTTTTAAAAATCCAGTTAGG + Intronic
936428675 2:112439717-112439739 AATTTTTTTCATATGGACTTTGG + Intergenic
936428686 2:112439903-112439925 CAGTTTTTATTAATAGAGTTCGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936854705 2:116942829-116942851 AAGTTTTCACAAATAGAGAGTGG + Intergenic
936913923 2:117620215-117620237 AACTTTTTCAAAATGGAGTAAGG - Intergenic
937097700 2:119246589-119246611 AAGTTCTCACACATGGAGTCTGG - Intronic
937119587 2:119432196-119432218 AAATCTTTCCAAATGAAGTTTGG - Intronic
937712550 2:124995071-124995093 AAGAATTTAAACATGGAGTTTGG + Intergenic
938664230 2:133517790-133517812 TAGGTTTTGCTAATGGAGTTGGG + Intronic
938819762 2:134945141-134945163 AAGGTTTTACAAAAGGGATTGGG - Intronic
941233057 2:162935333-162935355 AAGTTTTAAAAAAAGGAATTTGG + Intergenic
941803334 2:169685849-169685871 AATTTTTAACAAATGGTGCTGGG - Intronic
942520921 2:176802690-176802712 AACTTTTAATAAATGGTGTTAGG - Intergenic
943142712 2:184002606-184002628 AAGTTTTTACTCATGGTGGTGGG + Intergenic
943882630 2:193166026-193166048 AAGGTTTTACATATGTAATTAGG - Intergenic
944799230 2:203220783-203220805 AAGTATATAAAAATGAAGTTTGG + Intronic
946358673 2:219205992-219206014 AATTTTGTAGAAATGGGGTTGGG - Intronic
946550416 2:220795211-220795233 AAGTTTTAACACATGTATTTTGG - Intergenic
947176713 2:227374662-227374684 ATGATTTTACAAATGAAGTGTGG + Intronic
947300167 2:228680036-228680058 AAATTTTTTGAGATGGAGTTTGG - Intergenic
947626947 2:231625584-231625606 AAGTGTTTCCTAATGGAGCTTGG - Intergenic
947921520 2:233879351-233879373 AACTTTTTAAAACTGGGGTTTGG + Intergenic
948516487 2:238507014-238507036 AAGTTTTCAAAAATGTAGGTAGG - Intergenic
1169923864 20:10762524-10762546 AAGTTTTTAAAAAGCAAGTTAGG + Intergenic
1169939678 20:10923743-10923765 AACTTTTTAAAAATAGATTTAGG - Intergenic
1170116702 20:12868100-12868122 AACTTCGTACAAATGGAATTGGG - Intergenic
1170493164 20:16898836-16898858 ATGTTTATATAAATGGAGTTGGG - Intergenic
1170505017 20:17016363-17016385 GAGTTTTAATAAATGGTGTTGGG - Intergenic
1171090646 20:22283079-22283101 AATTTTTTTGAAAAGGAGTTTGG - Intergenic
1171279830 20:23886837-23886859 GAATTTTTAAAAATGTAGTTAGG + Intergenic
1172350656 20:34236872-34236894 AAGTTTTTGTATATGGTGTTAGG + Intronic
1173353544 20:42266211-42266233 CAGTTTTAAGGAATGGAGTTTGG + Intronic
1174948153 20:55011586-55011608 TATTTTTTAGAGATGGAGTTTGG + Intergenic
1174984000 20:55429146-55429168 AAATTTTAATAAATGGTGTTGGG + Intergenic
1175436570 20:58955649-58955671 AATTTTTTAAAAATAGAGATAGG - Intergenic
1175469807 20:59219447-59219469 AAGTCATTACAAATGCAGTGCGG + Intronic
1175957768 20:62620477-62620499 AAGTTTTTAATAATGGAAATGGG + Intergenic
1176153653 20:63607034-63607056 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153660 20:63607067-63607089 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153667 20:63607100-63607122 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153685 20:63607201-63607223 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153692 20:63607234-63607256 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153718 20:63607370-63607392 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153733 20:63607436-63607458 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153753 20:63607539-63607561 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153761 20:63607573-63607595 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153789 20:63607711-63607733 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153818 20:63607848-63607870 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153941 20:63608492-63608514 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153955 20:63608560-63608582 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153975 20:63608662-63608684 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153989 20:63608730-63608752 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154003 20:63608798-63608820 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154031 20:63608935-63608957 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154119 20:63609416-63609438 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154140 20:63609518-63609540 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154153 20:63609585-63609607 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154167 20:63609652-63609674 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154174 20:63609685-63609707 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154188 20:63609754-63609776 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154196 20:63609788-63609810 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154223 20:63609926-63609948 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154231 20:63609960-63609982 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176191744 20:63814395-63814417 AAGTTTTTAAAAATATAATTAGG + Intronic
1176649776 21:9534833-9534855 AACTTTTTAAAAATAGAGATGGG + Intergenic
1176879579 21:14174563-14174585 TATTTTTTAGAAATGGAGTCTGG + Intronic
1177446226 21:21199738-21199760 AAGTTTTTACAAACTGACATAGG - Intronic
1177738829 21:25127984-25128006 AGGATTTTTCAAAAGGAGTTTGG + Intergenic
1180256246 21:46630114-46630136 ATGTTGTTACAAATATAGTTGGG + Intergenic
1181183983 22:21088391-21088413 ATGTTTTTAAAAATAAAGTTTGG - Intergenic
1183613864 22:38929963-38929985 TAGTTTTTATAAATGGTGTAAGG + Intergenic
1184954341 22:47873682-47873704 GAGCTTTTAGAAATGTAGTTGGG + Intergenic
949372997 3:3355207-3355229 AAGTTTCAACATATGGATTTTGG - Intergenic
949969055 3:9386879-9386901 AAGATTTTACAAATCTAATTAGG + Intergenic
950844882 3:16005730-16005752 AATTTTTTATAAATGGTGTGAGG + Intergenic
951273432 3:20655961-20655983 AATTTTTTAAAAAGTGAGTTAGG - Intergenic
951901251 3:27659785-27659807 AAGTTATTACCACTAGAGTTAGG - Intergenic
955100158 3:55841123-55841145 AAGTTTTAACAAATTTATTTAGG - Intronic
955203895 3:56877666-56877688 CAGTTTTTAAAAATTGAGATCGG - Intronic
956148467 3:66216158-66216180 AAGTTTCTACACATGAATTTTGG + Intronic
956712310 3:72049365-72049387 TATTTTTTAAAAAAGGAGTTGGG - Intergenic
956872789 3:73434887-73434909 AAGTTTTTAGAAAAGGTGTCAGG - Intronic
957300164 3:78381535-78381557 AAGTTTTAACACATGAATTTGGG - Intergenic
957764154 3:84600028-84600050 TAGTTTTTATAAATGCAGTAAGG - Intergenic
958109263 3:89118563-89118585 AAGTTTTCACTAATAGGGTTAGG - Intronic
959090799 3:101900543-101900565 AGGTTATTGCAAATGGAGGTAGG + Intergenic
959467506 3:106706220-106706242 GAATTTTTACAAATGGAATAGGG + Intergenic
959567840 3:107850526-107850548 TATTTTTTACAAATAGAGTTTGG - Intergenic
960661344 3:120062992-120063014 AAGATTTTACAAAATGATTTTGG - Intronic
962353300 3:134672094-134672116 CATTTTTTACAGATGGGGTTTGG - Intronic
963030474 3:140968617-140968639 AAATTTTTATAAATGTTGTTAGG - Intronic
963262027 3:143202421-143202443 AAGTTGTTACAAATGAACATGGG - Intergenic
963398588 3:144766688-144766710 AATTTTTTACATAGGAAGTTTGG + Intergenic
963426397 3:145133243-145133265 AATTTTTTTGACATGGAGTTAGG - Intergenic
963816399 3:149836043-149836065 AAATTTTAAAAAATGGAGGTTGG - Intronic
964312952 3:155413881-155413903 ATGTTTATACAAATGGTGTGTGG - Intronic
965799737 3:172479414-172479436 AAGTTTTTAAAAATGTTGGTTGG + Intergenic
966294243 3:178400329-178400351 AAGTTTTTACTCATGGAGGAAGG - Intergenic
966606769 3:181828817-181828839 ATGTTTTTAGAAATGGGGTCTGG + Intergenic
966961232 3:184941513-184941535 AAGATTTTAGAATTGGAGTTGGG + Intronic
967584463 3:191195248-191195270 ATGTTTTTAAATATTGAGTTGGG - Intergenic
968711213 4:2119569-2119591 AAGCTTATATAAATGGAGTTAGG - Intronic
970104973 4:12571825-12571847 AAGTTTGTGGAAATAGAGTTAGG - Intergenic
970546545 4:17136015-17136037 CAGTCTTGACAATTGGAGTTTGG - Intergenic
970670973 4:18396429-18396451 TAGTTTTTAAGAATGGAGATGGG - Intergenic
971632768 4:29015786-29015808 AAGTTTCTTCCAATGGAGATAGG + Intergenic
972046484 4:34671421-34671443 ATATTTTTAAAAATGGAGATAGG + Intergenic
972050597 4:34727986-34728008 ACTGTTTTCCAAATGGAGTTGGG - Intergenic
972105723 4:35483510-35483532 AAATTTTTAAAAGTGGATTTTGG + Intergenic
972181354 4:36470666-36470688 AAGTTTTAACAAATGAATTTAGG - Intergenic
972997940 4:44905959-44905981 AAGTTTCTACAACTGGGGATTGG + Intergenic
973037960 4:45431183-45431205 AAGTTTTAACAAATTGAGTTTGG + Intergenic
973042019 4:45480414-45480436 AATTTTTAATAAATGGAGTAAGG - Intergenic
973770689 4:54203802-54203824 AAGTTTTGACATATGAATTTTGG + Intronic
973770953 4:54205967-54205989 AAGTTTTGACATATGAATTTTGG + Intronic
974485578 4:62500812-62500834 TACTTTTGCCAAATGGAGTTAGG - Intergenic
975072240 4:70156390-70156412 AAGTTTGTTCAAATGAACTTAGG - Intronic
975083770 4:70311810-70311832 AAGTTTTGAGACCTGGAGTTGGG - Intergenic
975113014 4:70648271-70648293 TAGTTATTAGAAATGAAGTTTGG - Intronic
975836682 4:78429774-78429796 CAGTTTCTACATATGGGGTTTGG + Intronic
975945221 4:79697343-79697365 AAGTTTTTAAAAATAAAATTTGG + Intergenic
976171881 4:82312767-82312789 AAATTTTTAAAAATGGAAGTTGG + Intergenic
977086859 4:92610667-92610689 AAAGTTCTACAAATGGATTTTGG - Intronic
977128104 4:93196164-93196186 AAATGTTTTCAAATGGTGTTGGG - Intronic
977731773 4:100362305-100362327 AAGTTTTGACAAAAGGAGTTTGG + Intergenic
977983782 4:103358896-103358918 AAATTTTTAGAATTGGAATTTGG - Intergenic
978072930 4:104493484-104493506 AAGTTTTTGCACTTGGAGTTTGG - Intronic
978617009 4:110607676-110607698 AAGTTTTAAAAAATCTAGTTTGG - Intergenic
978792161 4:112674015-112674037 TAACTTTTACAATTGGAGTTAGG + Intergenic
979230033 4:118338244-118338266 AAGTATATGCAAGTGGAGTTTGG - Exonic
979288313 4:118951459-118951481 AAGTTTTGACACATGAATTTTGG + Intronic
979390640 4:120123160-120123182 AATTTTTGACAAATGGCATTAGG - Intergenic
980784380 4:137533058-137533080 AAGTATTTACAGAGGGAGTGGGG - Intergenic
981177880 4:141703013-141703035 AAGATTTCACAAAGGGAGTGGGG + Intronic
981397483 4:144270867-144270889 AATTTTTTAAAAAAGGATTTGGG + Intergenic
982063739 4:151631622-151631644 AAGTTCTTACAAAAGCAGTTTGG - Intronic
982185509 4:152793521-152793543 AACTTAGTACATATGGAGTTTGG - Intronic
983307960 4:166018046-166018068 AAGAGTTTATAAATTGAGTTCGG + Intronic
984398881 4:179235969-179235991 AAGGCTTTACAAATGCATTTAGG - Intergenic
984709930 4:182876429-182876451 AAGTTTTGACATATGAATTTGGG - Intergenic
984967272 4:185150502-185150524 AAGTGGTTACAAATGAAGTTTGG - Intergenic
985213535 4:187622466-187622488 AAGTTTTAACAGATGAATTTTGG - Intergenic
986190098 5:5488720-5488742 AAGCATTTATAAATGGACTTTGG - Intronic
986534401 5:8771976-8771998 CAGTATTTACAAATAGGGTTTGG + Intergenic
987026338 5:13930385-13930407 AAATTTTAACAACTGGATTTGGG - Intronic
987438143 5:17923214-17923236 AAGTTTTTTTATATGAAGTTTGG + Intergenic
987474159 5:18370149-18370171 AAGTTTTTAAAAATAGAGGATGG + Intergenic
988360308 5:30229249-30229271 AAGTCTTTACAAATGACCTTTGG + Intergenic
991619850 5:68534137-68534159 AAGTTACCACAAGTGGAGTTTGG + Intergenic
992294969 5:75318658-75318680 AACTTGTTACAAAAAGAGTTAGG + Intergenic
992947674 5:81825309-81825331 AAATTCTTGCAAATGTAGTTGGG + Intergenic
994337296 5:98582538-98582560 AAATTTTTATAAATGGGGCTAGG - Intergenic
994493333 5:100476609-100476631 AATTTTTTAAAAATAGAGATAGG - Intergenic
994759533 5:103835629-103835651 AAGTTTCAACAAATGAATTTGGG - Intergenic
994864155 5:105243483-105243505 CAGTTTTTGAAAGTGGAGTTGGG + Intergenic
995568079 5:113452333-113452355 AAGTTTTAACATATGAATTTGGG - Intronic
996896474 5:128489288-128489310 AACTTGTTACAAATTTAGTTTGG + Intronic
997912304 5:137888423-137888445 TAGTTTTAACAAAAGGATTTGGG - Intronic
998313874 5:141161618-141161640 ACTTTTTTAAAAATTGAGTTTGG + Intergenic
998498831 5:142614404-142614426 AAGTTCTAAAAAATGCAGTTTGG - Intronic
999461699 5:151762350-151762372 AAGTTTTTAAAAAGGGTGATGGG + Intronic
999971374 5:156867237-156867259 AATTTTTTAAAAATAGAGATAGG - Intergenic
1000211374 5:159109174-159109196 AAGTTTCTAGAAATGGACTGTGG - Intergenic
1000501666 5:162058970-162058992 AAGATTATATAAATGGAATTAGG + Intergenic
1001068114 5:168556369-168556391 GTATTTTTATAAATGGAGTTTGG + Exonic
1001151405 5:169231433-169231455 AAGTTTACACAAATGGAATCAGG + Intronic
1001188120 5:169597633-169597655 AAGATTTTATAAATTGACTTAGG + Intronic
1001278683 5:170369996-170370018 AAGTTTATACAAGTAGAGTCAGG + Intronic
1001605056 5:172953704-172953726 AAGTTTTCACAAATGGTGATTGG + Intergenic
1001857209 5:175023392-175023414 TAGTTCTCACAAATGGGGTTGGG - Intergenic
1002688149 5:181031748-181031770 TAATTTTTTCAAAAGGAGTTAGG + Intergenic
1004242465 6:13937392-13937414 AACTTTATACAAATGGAATCAGG + Intronic
1004285852 6:14320024-14320046 ATCTTTTTACAAATGGAGCAAGG - Intergenic
1005417832 6:25620513-25620535 ATGATTTTACAAGTGGAATTTGG + Exonic
1005938395 6:30542475-30542497 CAGTTTATGCAAATGGAGCTTGG - Exonic
1006730716 6:36234191-36234213 AAGCCTTGACAAATGGGGTTAGG + Intergenic
1006827722 6:36948468-36948490 AAGTTTTTAGAAATAGAGAAAGG + Intronic
1008565985 6:52768774-52768796 AAGTTTGTACAAATGGAAAGGGG - Intergenic
1009532613 6:64839940-64839962 AAGTTTTAACACATGAATTTTGG + Intronic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011104250 6:83761507-83761529 GAGTTTTTAAAAATGTATTTTGG - Intergenic
1011183987 6:84653774-84653796 AGGTTTTAACACATGGATTTTGG + Intergenic
1011747088 6:90416874-90416896 TAGTTTATAAAAAGGGAGTTAGG - Intergenic
1012787378 6:103648203-103648225 CAGTTTATCCAAATAGAGTTTGG - Intergenic
1012897944 6:104973124-104973146 AAGTCTTAACAAATGATGTTTGG + Intronic
1013317322 6:108955199-108955221 AAGGTTTTAAAAATGGAGGCTGG + Intronic
1014376576 6:120682531-120682553 ATGTTTTTATAAATGGTGTAAGG - Intergenic
1014404920 6:121039523-121039545 AAGTTTTTAAAGATGGTGTCTGG + Intergenic
1014438193 6:121443924-121443946 AATTTTTTACAAACAGAATTAGG + Intronic
1015291871 6:131546693-131546715 AAGTTATTACAAATGAAGAAAGG - Intergenic
1016176826 6:141088309-141088331 AAGTTTTTAGAAACAAAGTTTGG - Intergenic
1016450771 6:144179968-144179990 GAGTCTTTGCAAATGGAATTCGG - Intronic
1017265654 6:152442599-152442621 AATTTTTAAAAATTGGAGTTGGG - Intronic
1017402130 6:154076702-154076724 TAGTTTATAAAAAAGGAGTTAGG - Intronic
1017431829 6:154378943-154378965 TACTTTTTACAAATAGACTTGGG + Intronic
1018355414 6:163010289-163010311 ATTTTTTTAAAAATGGATTTTGG - Intronic
1018444922 6:163847320-163847342 TAGTCTTTTCAAATGGTGTTAGG - Intergenic
1018959632 6:168439095-168439117 AAAATTCTAGAAATGGAGTTTGG - Intergenic
1020373456 7:7459993-7460015 AAGTTGGGACAAATGGAGTTAGG - Intronic
1021173754 7:17426114-17426136 AAGTTTCAACAAATGAATTTTGG - Intergenic
1021796223 7:24257118-24257140 AGGTTTTTATAAATGTATTTGGG - Intergenic
1022179202 7:27902026-27902048 AATTTTTTAAAAATAAAGTTTGG + Intronic
1022215302 7:28254127-28254149 GAGTTTTGACAAATGCAGGTGGG + Intergenic
1022811948 7:33878164-33878186 AAATTTTTAAAAATATAGTTTGG + Intergenic
1022815236 7:33906635-33906657 AAATTATTGAAAATGGAGTTGGG + Intronic
1023235996 7:38087997-38088019 AATTTTTTGCAAATGGTGTGAGG + Intergenic
1023383580 7:39632808-39632830 AATTTTTTAAAAATTGAGATGGG - Intronic
1023398385 7:39772926-39772948 CATTTTTTTTAAATGGAGTTTGG - Intergenic
1023574764 7:41615367-41615389 AGTTATTTACAAATGGTGTTTGG + Intergenic
1024992870 7:55250110-55250132 CAGTTTTGACAACAGGAGTTTGG - Intronic
1025134269 7:56397564-56397586 CATTTTTTTTAAATGGAGTTTGG + Intergenic
1027331951 7:77106422-77106444 TAGATTTTACAAGTAGAGTTTGG - Intergenic
1027781123 7:82521591-82521613 AAGATTTTAGAAATTGAGATTGG + Intergenic
1028294991 7:89117851-89117873 AAGTTTTTACATTTTGAGTTTGG + Intronic
1028331460 7:89599940-89599962 AAGTTTTAACATATGAATTTTGG - Intergenic
1029363988 7:100105803-100105825 AAGCTTTGGCTAATGGAGTTGGG + Intronic
1029882012 7:103823871-103823893 AATTTTTTAAAAATGCAGTTTGG - Intronic
1030113318 7:106044606-106044628 AAGTTTCTTCAAATGATGTTGGG - Intergenic
1030810458 7:113966476-113966498 AAGATTTTACAAATACTGTTTGG + Intronic
1031327974 7:120426270-120426292 AATGTTATACAAATGAAGTTTGG - Intronic
1031334946 7:120516676-120516698 AAATTTTTATTAACGGAGTTTGG - Intronic
1031616385 7:123886734-123886756 AAATTTTTACATATGGTGTGAGG - Intergenic
1031824945 7:126552534-126552556 AAGTATATAGAAATGGATTTTGG - Intronic
1031845914 7:126805901-126805923 AAGTTTGTACAAATGGAAACTGG - Intronic
1033670771 7:143490635-143490657 AAATTTTTAAAAATGGATTTTGG + Intergenic
1034599411 7:152234740-152234762 AAAATTTTAAAAAAGGAGTTGGG + Intronic
1034909973 7:154987870-154987892 GAGTTTTGACAAATGGAGATGGG - Intronic
1034933221 7:155180743-155180765 AAGTTTTTGCCATTAGAGTTGGG + Intergenic
1036677326 8:10845720-10845742 AAGTTATTACAAGTGTATTTTGG + Intergenic
1038348111 8:26750607-26750629 ATGTTTTAACATATGGATTTTGG + Intronic
1038377087 8:27051260-27051282 AAGATTTTACAAATGTAGTGAGG - Intergenic
1038468115 8:27785315-27785337 AAGTTTTCACACATGAACTTTGG + Intronic
1039147362 8:34463924-34463946 ATGTTACTGCAAATGGAGTTTGG - Intergenic
1039263706 8:35801953-35801975 AAATTTTTAAAAATTTAGTTGGG - Intergenic
1041850650 8:62388227-62388249 TAGTTTTTAGAAATGTATTTGGG + Intronic
1042233212 8:66580638-66580660 AAGTGTTGAGAAATGAAGTTTGG - Intronic
1042394021 8:68270208-68270230 AATTTTTTAAAATTGGACTTGGG + Intergenic
1043234293 8:77842174-77842196 AAGTTTTTGAAATTTGAGTTAGG + Intergenic
1044334459 8:90962795-90962817 ATGTTTGGACAAATGGACTTTGG - Intronic
1044742601 8:95343037-95343059 AAGTTTCTACATATGAATTTTGG + Intergenic
1044775490 8:95682705-95682727 AACCTCTTACAAATGGATTTTGG + Intergenic
1044823771 8:96177489-96177511 AGATTTTTCTAAATGGAGTTGGG + Intergenic
1044868785 8:96598261-96598283 AGGTTTTAACACATGGATTTTGG + Intronic
1045130443 8:99146213-99146235 AATTTTTTACATAAGGAGTGAGG + Intronic
1045283011 8:100765855-100765877 TATTTTTTTTAAATGGAGTTTGG + Intergenic
1045629701 8:104104095-104104117 AAGTTATTAGATAAGGAGTTGGG + Intronic
1045851646 8:106706717-106706739 AACATTCTACAAATGAAGTTGGG + Exonic
1045916664 8:107480255-107480277 AAGTTAGTACAAATGTATTTTGG - Intronic
1045956218 8:107910884-107910906 AATTTTTTAAAAATAGAGATGGG - Intronic
1045983881 8:108224944-108224966 AAGTTTTTAAAAATTAATTTGGG - Intronic
1046069173 8:109229948-109229970 AATTTTAGGCAAATGGAGTTTGG - Intergenic
1046471797 8:114684858-114684880 TCATTTTTACAAATTGAGTTAGG + Intergenic
1046948806 8:120000773-120000795 AAGTTTTTAAAAATGAATTGAGG + Intronic
1047401086 8:124548022-124548044 AAGCTTTAACATCTGGAGTTTGG + Intronic
1048102963 8:131375132-131375154 TAATTTTTACAAATGGTGATAGG - Intergenic
1048492739 8:134909631-134909653 AAGTTTTAACACATGAAATTTGG + Intergenic
1048533438 8:135271550-135271572 TGGTTTGTAAAAATGGAGTTGGG + Intergenic
1048659961 8:136588210-136588232 AAGTGTTTAAAAATGAAGTGGGG + Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050452634 9:5799459-5799481 AAGTTATTTCAAATGGAGCACGG - Intronic
1051036916 9:12758462-12758484 AGGTTTTAACCAATGAAGTTTGG - Intergenic
1052062748 9:23981285-23981307 AACTTCTTTCAAATGGAGTTCGG - Intergenic
1052480883 9:29024210-29024232 AAGTTTCTAAATATGGGGTTTGG - Intergenic
1052536029 9:29748649-29748671 AAGTTTTTTCAAATAGTTTTAGG - Intergenic
1053292104 9:36887401-36887423 GACTTTTTATAAATGGTGTTAGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055868657 9:80846564-80846586 TAGCTTTTACAAATGGAGAGAGG - Intergenic
1058005944 9:99914372-99914394 AAGTTTCTACAACTGAAGTAGGG + Intronic
1058089931 9:100794174-100794196 TAGTATATACAAATGCAGTTGGG + Intergenic
1058109842 9:101020197-101020219 AAGGATCTACAAATGGATTTTGG - Intergenic
1058541292 9:106015030-106015052 AAGTTTTGACATATGAACTTGGG + Intergenic
1058669187 9:107346390-107346412 AATGTTTAATAAATGGAGTTGGG + Intergenic
1059286292 9:113174674-113174696 GAGTTTTCAGAAATGGAGTAAGG - Intronic
1060453635 9:123767891-123767913 AATGTTTTATAAATGCAGTTAGG - Intronic
1062082596 9:134632260-134632282 AATTTTTAACAAATGAAGCTTGG + Intergenic
1203627518 Un_KI270750v1:38381-38403 AACTTTTTAAAAATAGAGATGGG + Intergenic
1186131488 X:6470769-6470791 AAGTATTTAAAAATCGAGTTGGG + Intergenic
1186515177 X:10161441-10161463 AAATTTTTAAAAAGGGAGGTGGG + Intronic
1187355331 X:18564580-18564602 AAGTTTTTATACATAGAGTGTGG + Intronic
1187672591 X:21683445-21683467 AAATATTTACAAATGAAGTGAGG + Intergenic
1188593305 X:31865440-31865462 AATTTTTTAAAAGTGGTGTTCGG - Intronic
1189746942 X:44178643-44178665 AAGTTTTGTAAAATGGAATTTGG - Intronic
1189923556 X:45929474-45929496 AAGTTCTTACCGATGGAGCTGGG + Intergenic
1190933384 X:54970208-54970230 AGGTTTTTAAAAATAGATTTTGG - Intronic
1192448393 X:71227112-71227134 AATTTTTTAAAAATAGAGATGGG - Intergenic
1192608118 X:72541179-72541201 AATTTTTTAAAAATGTGGTTAGG + Intronic
1193335888 X:80288526-80288548 AAGTTCTTTCAAATGCAGTTGGG + Intergenic
1193826630 X:86234436-86234458 AAGTCTATAAAAATGGGGTTGGG - Intronic
1194563872 X:95457226-95457248 AAGTATTAACTAGTGGAGTTAGG + Intergenic
1198099300 X:133410513-133410535 ATGTTTTTAAAAATGTATTTTGG - Intronic
1198867077 X:141134760-141134782 AATTTATTACAAAAGGATTTTGG + Intergenic
1199799535 X:151235903-151235925 AAGGTTTCTCAAATGGAGGTGGG - Intergenic
1200286871 X:154831175-154831197 GAGTTTCTACTAATTGAGTTGGG - Intronic
1201501699 Y:14650596-14650618 ATATTTTTATATATGGAGTTAGG + Intronic
1201712500 Y:17008020-17008042 AGGTTTTCACAAATGAATTTTGG - Intergenic