ID: 1120795939

View in Genome Browser
Species Human (GRCh38)
Location 14:88632834-88632856
Sequence CTGGACTCTGAGACTTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120795937_1120795939 -10 Left 1120795937 14:88632821-88632843 CCCAATAAAAACTCTGGACTCTG 0: 2
1: 12
2: 77
3: 274
4: 959
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223
1120795932_1120795939 5 Left 1120795932 14:88632806-88632828 CCTATGTGACCAACCCCCAATAA 0: 2
1: 7
2: 28
3: 103
4: 261
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223
1120795931_1120795939 6 Left 1120795931 14:88632805-88632827 CCCTATGTGACCAACCCCCAATA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223
1120795936_1120795939 -9 Left 1120795936 14:88632820-88632842 CCCCAATAAAAACTCTGGACTCT 0: 1
1: 12
2: 82
3: 191
4: 636
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223
1120795933_1120795939 -4 Left 1120795933 14:88632815-88632837 CCAACCCCCAATAAAAACTCTGG 0: 2
1: 3
2: 32
3: 88
4: 309
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223
1120795935_1120795939 -8 Left 1120795935 14:88632819-88632841 CCCCCAATAAAAACTCTGGACTC 0: 1
1: 10
2: 32
3: 75
4: 311
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120795939 Original CRISPR CTGGACTCTGAGACTTCAGT AGG Intronic
900946363 1:5833413-5833435 CGTGACTCTGAGTTTTCAGTTGG + Intergenic
900984853 1:6067129-6067151 CTGGACTCAGAGACTTACATGGG - Intronic
901215764 1:7554488-7554510 CAGGATTCTGAGACTGCATTTGG - Intronic
901236118 1:7668508-7668530 CAGGACTCAGAGACCTCAGATGG + Intronic
901800570 1:11705809-11705831 CTGGCCCCTGAGACTTGACTCGG - Intronic
903534749 1:24059603-24059625 TGGGACTCTGAGACTTCAACTGG + Intronic
904027765 1:27515345-27515367 CAGGAATTTGAGACTGCAGTGGG + Intergenic
905858573 1:41330988-41331010 CAGGACTCCGAGACTTTGGTGGG - Intergenic
907832440 1:58077825-58077847 CTGCCCTCTGAGACTTGAGGTGG - Intronic
908841559 1:68285233-68285255 GGGGACTCTGAGAACTCAGTAGG + Intergenic
911572944 1:99539853-99539875 TAGGCCTTTGAGACTTCAGTAGG - Intergenic
912703076 1:111893119-111893141 CTGGACTGTGAGCCTTCAGAGGG - Intronic
915627994 1:157127917-157127939 CAGGTCCCTGAGACTTCAGATGG - Intronic
915918729 1:159958380-159958402 CTGGACTCGGAGAGCTCAGTGGG - Intergenic
916231057 1:162541749-162541771 CTGGACTCTGAAAATCCATTTGG - Intergenic
916828934 1:168471336-168471358 CTGGGCTCTGACTCATCAGTGGG - Intergenic
917398151 1:174616467-174616489 CTGGTGCCTGAGACTTTAGTAGG - Intronic
919420950 1:197369670-197369692 TGGGACGCTGGGACTTCAGTGGG - Intronic
920668552 1:207984746-207984768 CAGGAGGCTGAGACTGCAGTGGG + Intergenic
920856279 1:209665082-209665104 CTGAGCTCTGAGACTTCACCAGG + Intergenic
920915347 1:210253951-210253973 GGTGACTCTGAGACTCCAGTTGG - Intergenic
1063924568 10:10965050-10965072 CTGGACTCTAAGAATTGGGTTGG - Intergenic
1063926307 10:10981088-10981110 ATAGACTCTGGGACTTCAGTGGG - Intergenic
1064119978 10:12610140-12610162 CTGGATTCAATGACTTCAGTTGG - Intronic
1067720989 10:48727607-48727629 CTGGAGTTTGAGAATTCAGAGGG + Exonic
1067988804 10:51184938-51184960 CTGGACACTGAGAGATCAATTGG - Intronic
1068749564 10:60576343-60576365 CTGTTCTACGAGACTTCAGTTGG - Intronic
1070703262 10:78618733-78618755 ATGGACACAGAGCCTTCAGTAGG - Intergenic
1071093094 10:81943305-81943327 CAGGACTTTGAGGCTGCAGTGGG + Intronic
1072458477 10:95598128-95598150 CAGGAATTTGAGACTGCAGTGGG - Intergenic
1073914731 10:108389140-108389162 CTGGGCTCTGAAACCTCAGTGGG + Intergenic
1075408575 10:122211038-122211060 CTGGACTCAGAGAGTGCAGAAGG + Exonic
1081202227 11:40230502-40230524 CAGAACTCCCAGACTTCAGTTGG + Intronic
1081324891 11:41732132-41732154 CTGGAATCTGAGACCTAACTTGG + Intergenic
1082938452 11:58678568-58678590 CTATACTCTCAGACTACAGTGGG - Intronic
1084596116 11:70118031-70118053 CTGGACTCTGAGGCTGGAATTGG - Intronic
1085255797 11:75172285-75172307 CTGGCCTCTGAGACATGAGGTGG - Intronic
1088765855 11:112976553-112976575 CTGGACACTGAAACTTCACAGGG + Intronic
1089242771 11:117097085-117097107 CTGGAATCTAAGACATCAGGAGG - Intronic
1093917749 12:24824370-24824392 CAGGAATGTGAGACTGCAGTGGG - Intronic
1095273764 12:40254551-40254573 CTGGACTTTGTGGCTTCTGTTGG + Intronic
1095785991 12:46109599-46109621 GTGCACTCTTAGACTCCAGTAGG + Intergenic
1096777140 12:53971197-53971219 CTGAAGTGTGAGACTTCTGTTGG - Intergenic
1096864359 12:54553039-54553061 CTGGATGCTGAGAATACAGTCGG + Intronic
1097717300 12:62980491-62980513 CTGAACTGTCAGTCTTCAGTGGG + Intergenic
1098429248 12:70401792-70401814 CTGGCCTCTCATTCTTCAGTAGG + Intronic
1098629831 12:72711129-72711151 CTGGAGTTTGAGACATCAGTCGG + Intergenic
1100373366 12:93990277-93990299 CTGGCCTCAGAGATGTCAGTTGG + Intergenic
1101408505 12:104450260-104450282 CTGGTCTCTGAGCTTTCAGAGGG - Intergenic
1101734916 12:107455976-107455998 CTGGACTTTGTGGCTTCATTTGG - Intronic
1102273045 12:111556300-111556322 CAGGAGTCTGAGGCTGCAGTAGG + Intronic
1104512249 12:129391538-129391560 CTGAATTCTGAGACCTCACTGGG - Intronic
1104998272 12:132672691-132672713 CTGGACTCTGAGACCTACGTCGG - Exonic
1106027384 13:25968145-25968167 CTGGGCTCTCTGACTGCAGTTGG + Intronic
1110592233 13:77276738-77276760 CAGGAGTCTGAGGCTACAGTCGG - Intronic
1114805923 14:25836635-25836657 CTGGACTCCACGTCTTCAGTCGG + Intergenic
1115386439 14:32803510-32803532 CTCGACTCTGGGAGTTAAGTAGG - Intronic
1115387887 14:32819228-32819250 CTGGACTCTTAAACTTAAGTAGG + Intronic
1116888889 14:50248387-50248409 CTGCCCTCTAAGACTTCAGCTGG + Intronic
1117194597 14:53327118-53327140 CTGGAGAATGAGACTTCACTGGG + Intergenic
1118676383 14:68189222-68189244 CTGGGCTGTGAGCCTTCAGAGGG + Intronic
1119147779 14:72332467-72332489 CTGTTCTCTGAGAGGTCAGTTGG - Intronic
1119194314 14:72705777-72705799 CTGGACTGTGAGCCTTCTGAGGG - Intronic
1119938131 14:78611812-78611834 CTAGGCTTTGAGACTTCAGAAGG + Intronic
1120268730 14:82283456-82283478 ATAGACTCTGAGAATACAGTTGG - Intergenic
1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG + Intronic
1121521951 14:94592143-94592165 CTAGCCTCTGAGAGTTCAGGCGG - Exonic
1121912715 14:97806584-97806606 CAGGACATGGAGACTTCAGTGGG + Intergenic
1122030170 14:98906256-98906278 CAGGACTCTGAGATTCCAGATGG + Intergenic
1123995388 15:25714354-25714376 CTGTGCTCTGAGACCCCAGTGGG - Intronic
1124002632 15:25771638-25771660 CTTTCCTGTGAGACTTCAGTTGG - Intronic
1126711136 15:51457271-51457293 TTGGACTCTGAAAAATCAGTTGG - Intronic
1127006027 15:54571116-54571138 CTGGAAACTGAGACTTCATTTGG - Intronic
1128571120 15:68733608-68733630 CTGGACAATGACACTACAGTAGG + Intergenic
1130808246 15:87350074-87350096 ATGGACTCAGAGACATCATTTGG + Intergenic
1130987709 15:88855488-88855510 CTGGAGTAGGAGACCTCAGTGGG + Exonic
1131017282 15:89068384-89068406 CTGGTGTCTGAGACCTCAGCTGG + Intergenic
1131205178 15:90439079-90439101 CTGGACTGGGAGAAATCAGTAGG - Intronic
1132084078 15:98892228-98892250 CTGAACTTTGAGACTTCACTTGG + Intronic
1132120794 15:99173510-99173532 CAGGAGTCTGAGGCTGCAGTGGG + Intronic
1133399653 16:5475877-5475899 CAGGAGTTTGAGACTGCAGTGGG - Intergenic
1137069486 16:35888952-35888974 CTGGCCTCTGACCTTTCAGTTGG + Intergenic
1138214181 16:55188809-55188831 CATGAATGTGAGACTTCAGTGGG + Intergenic
1139356839 16:66371711-66371733 CTGGAATCTAAGGCTTGAGTGGG + Intronic
1139393071 16:66618115-66618137 CTGGATTCTGCAACTTCACTAGG + Intronic
1139780649 16:69348687-69348709 CTGGAGGCAGAGACTGCAGTGGG - Intronic
1140498536 16:75411467-75411489 CTGATTTCTGAGACTTCAATGGG + Intronic
1141995651 16:87635040-87635062 CTGGACTCTGGGACAGTAGTGGG + Intronic
1143054926 17:4155696-4155718 CTGGTCTCTGAGACTCCAGGAGG + Intronic
1143234998 17:5392128-5392150 CTGGAAACTGAGACCTCAGATGG + Intronic
1144452033 17:15389139-15389161 CTGGCCACTGAGACATGAGTGGG + Intergenic
1145972033 17:28961818-28961840 CTGGTCTCTGAGAGTTGGGTAGG - Intronic
1148986886 17:51630256-51630278 CAGGACTCAGAGACTTCAGCAGG + Intergenic
1148990987 17:51667232-51667254 CTGGATTCTGAGATTTAACTTGG - Intronic
1149565538 17:57638298-57638320 CTGCTCTCTGTCACTTCAGTTGG + Intronic
1149934355 17:60790190-60790212 CTGGACTGATATACTTCAGTAGG + Intronic
1152057633 17:78043196-78043218 CTGCAGCCTGAAACTTCAGTGGG + Intronic
1152249691 17:79205396-79205418 CTGGTCTCTGAGTCTGCATTTGG + Intronic
1155176107 18:23302664-23302686 CTGGGCTCTGAGACTACAGAAGG - Intronic
1158214846 18:55089459-55089481 CTGGACTCTGAGAAGTAAGGGGG - Intergenic
1159923305 18:74246164-74246186 CTGGACTCTGTGCCTTCAGTAGG + Intergenic
1160089024 18:75808523-75808545 CTTGACACTGAGACTTCACTTGG + Intergenic
1160206079 18:76833811-76833833 CTGGGCTTTGAGATTTCTGTGGG + Intronic
1161202837 19:3025459-3025481 CTGGAATCTGGGACTCCAGGCGG - Intronic
1162789941 19:13057625-13057647 CAGGACTCTGAGACACTAGTGGG - Intronic
1163425760 19:17240319-17240341 CTGGCCTCTGAGGCTGGAGTCGG + Intronic
1164452596 19:28379893-28379915 CTGGACTCAGAGACTTGAGGGGG - Intergenic
1164593058 19:29516723-29516745 CTGCACTGTGGGACTGCAGTAGG - Intergenic
1165771298 19:38381891-38381913 CAGGAGTCAGAGATTTCAGTGGG + Intronic
1166642704 19:44507820-44507842 CAGGAATCTGAGGCTGCAGTTGG + Intronic
1167706998 19:51086984-51087006 CTGAGCTGTGAGTCTTCAGTGGG - Intergenic
1168041694 19:53764019-53764041 CTGGTCCCAGAGACTTCATTTGG + Intergenic
926869248 2:17394362-17394384 ATGGACTTTGAGACCTCAGGAGG + Intergenic
929566302 2:42987933-42987955 CAGGAGTTTGAGACTGCAGTGGG - Intergenic
931490445 2:62739860-62739882 CAGGAGTCTGAGGCTGCAGTGGG + Intronic
932686051 2:73871180-73871202 ATGGCCTTTGAGACTTCAGCTGG + Intronic
934038877 2:88111191-88111213 CTGGACTTTAAGACCTCAGTTGG - Exonic
934766787 2:96884272-96884294 CTGGGCTCTCAGCCTTCAGCAGG + Intronic
935026751 2:99284489-99284511 GTGGACTCTGTGCCTACAGTGGG - Exonic
935841435 2:107115960-107115982 CTGGACTCCCAGATTTCATTTGG - Intergenic
936254873 2:110903066-110903088 CTGGACTCTGAGACTTCTTAGGG - Intronic
936976581 2:118226961-118226983 CTGGATTCTGAGATCCCAGTGGG + Intergenic
939073143 2:137567818-137567840 CTGGACTGTAATAGTTCAGTTGG - Intronic
939822344 2:146972445-146972467 ATGGACTTTGAGGATTCAGTTGG + Intergenic
940397245 2:153204119-153204141 GTAGACTCTCAGACTTCTGTTGG + Intergenic
941714946 2:168754110-168754132 CTGGACTCTGATACTTAACACGG - Intronic
942084801 2:172433847-172433869 CTGAACACTGAGACCTCACTGGG - Intronic
942638093 2:178030665-178030687 CTGGAGTTTGAGACTAGAGTGGG + Intronic
945563498 2:211367633-211367655 TTGGATCCTGAGACTTGAGTAGG + Intergenic
945609048 2:211975055-211975077 CAGGACTTTGAGGCTGCAGTGGG - Intronic
945684158 2:212949108-212949130 GTGGACGCTGAGAAATCAGTAGG - Intergenic
945732292 2:213553675-213553697 CTGGGCTCTGTGACTACAATAGG + Intronic
947632870 2:231665264-231665286 CTGCACTCTGGGACACCAGTTGG + Intergenic
948642684 2:239385526-239385548 CTTGAGGCTGAGACTTCAGAGGG - Intronic
1168936817 20:1672814-1672836 TTGGAATCTGGGTCTTCAGTTGG + Intergenic
1170024629 20:11875421-11875443 CTGGACTCTTAGCCTTGATTGGG - Intergenic
1170329162 20:15189638-15189660 CTGGAATATGAGAATTCAGTAGG + Intronic
1170387814 20:15839387-15839409 CTTGGCTCTGTGACTTCTGTCGG + Intronic
1170718255 20:18851113-18851135 CAGGAGTCTGAGGCTGCAGTGGG - Intergenic
1171157471 20:22889646-22889668 TTGGGTTCTGTGACTTCAGTGGG - Intergenic
1172077852 20:32313207-32313229 CTGGACTCTGAGCTTCCACTGGG + Intronic
1172839043 20:37891039-37891061 CTGTCTTCTGAGGCTTCAGTGGG - Intergenic
1173111773 20:40197669-40197691 CTGGAGTCTGAGCCTTTTGTGGG - Intergenic
1175278775 20:57788763-57788785 CTGCCCTCTGTGACTTCACTCGG + Intergenic
1175306507 20:57979431-57979453 CTGGACACTAAGACCACAGTGGG - Intergenic
1175306515 20:57979477-57979499 CTGGACACTGAGACCAAAGTGGG - Intergenic
1175306542 20:57979615-57979637 CTGGACACTGAGACCACAGTGGG - Intergenic
1175306551 20:57979661-57979683 CTGGACACTGAGACCACAGTGGG - Intergenic
1175306560 20:57979707-57979729 CTGGACACTGAGACCACAGTGGG - Intergenic
1177917975 21:27114626-27114648 CTGGGCTCTGCCCCTTCAGTAGG + Intergenic
1180090954 21:45533635-45533657 CTGGACTCTGGGCCTCCAGCAGG + Intronic
1180468031 22:15634658-15634680 CTGGACTCAGAGGCTTCCCTAGG + Intergenic
1181858008 22:25796520-25796542 CAGGAGTTTGAGACTGCAGTGGG + Intronic
1182438539 22:30347221-30347243 CAGGAGTCTGAGGCTGCAGTGGG + Intronic
1183177519 22:36235248-36235270 TTGTATTCTGACACTTCAGTGGG + Intronic
951547129 3:23838139-23838161 CGGGAGGCTGAGACTGCAGTAGG - Intronic
951601536 3:24381397-24381419 CAGGACTCTGAGGGGTCAGTAGG + Intronic
954681961 3:52350709-52350731 CTGGCCTCTGAAATCTCAGTGGG - Intronic
955066455 3:55537329-55537351 CTGGAGTCTGTCACTTCAGGGGG - Intronic
955067807 3:55547632-55547654 CTGGTCTCTGAGACTTCCTGGGG - Intronic
955285086 3:57632391-57632413 CAGGACTTTGAGACTACAGTAGG - Intronic
955555844 3:60136389-60136411 CTGGAATCTGAAATTTAAGTTGG - Intronic
956373407 3:68588419-68588441 CTAGACCCTGAGGATTCAGTGGG + Intergenic
956970706 3:74521921-74521943 CTGGACTCCTACAATTCAGTTGG + Intergenic
958467347 3:94473837-94473859 TTGGACTTTGGGACTACAGTTGG - Intergenic
960547079 3:118927666-118927688 GTAGATTCTGAGACTTGAGTAGG + Intronic
961018303 3:123483754-123483776 CTGGGCCCTGAGAATACAGTGGG + Intergenic
962837992 3:139205675-139205697 CTGCACTCAGAGCCTTTAGTTGG - Intronic
964310295 3:155385151-155385173 CTGGCCTCTGAAACTCCAGAGGG - Intronic
965126333 3:164634846-164634868 CTGGACTGTGAAACTTCTTTGGG + Intergenic
965665276 3:171087337-171087359 ATGGACTCTGGGACTGAAGTAGG - Exonic
967251577 3:187545589-187545611 CTGGAATTTGAGGCTGCAGTGGG - Intergenic
968186729 3:196637912-196637934 CAGGACTCTGAGACTGAGGTGGG + Intergenic
968664197 4:1811738-1811760 CTGGACTGTGACACTGCAGAAGG + Exonic
969755632 4:9148246-9148268 CAGGAATCTGAGGCTGCAGTGGG + Intergenic
971521016 4:27550522-27550544 CTGGACTCTGAGGTTTAAGCAGG - Intergenic
974701947 4:65462548-65462570 CAGGAGTCTGGGGCTTCAGTGGG + Intronic
987244586 5:16036121-16036143 CTGTTCTCTGAGTCTGCAGTAGG - Intergenic
987686070 5:21203776-21203798 TTAGAGTCTGAGACATCAGTAGG + Intergenic
989260608 5:39415757-39415779 CTGGACTCTTACACTTCATGCGG - Intronic
991443807 5:66679046-66679068 CTGTAATCTCAGACTTCAGGAGG - Intronic
997053964 5:130418190-130418212 CTGGACTCTGAGCTTCCATTGGG + Intergenic
998862847 5:146461470-146461492 ATGGTATCTAAGACTTCAGTGGG - Intronic
999062244 5:148648417-148648439 TTGGACTCTGATGCTTCAGTGGG - Intronic
1000531279 5:162423296-162423318 CTAGACTCTGACTCTTCAGTAGG + Intergenic
1000543792 5:162573612-162573634 CTGGTGTCTGGGACTTCACTTGG + Intergenic
1001260212 5:170222072-170222094 CAGGAGGCTGAGACTTCAGTGGG + Intergenic
1001296282 5:170501575-170501597 CTGTACTCTGCTTCTTCAGTGGG + Intronic
1001745650 5:174090441-174090463 CTGGAGTCTGAAACTTGGGTGGG - Intronic
1001897913 5:175397274-175397296 ATGGACTGTGAGACTTGGGTGGG - Intergenic
1002330555 5:178437621-178437643 CTGGGCCCTGAGAACTCAGTGGG - Intronic
1002889917 6:1323703-1323725 CAGGACTCTGAGCCTTGAGCAGG + Intergenic
1003137819 6:3446602-3446624 CTGGCCTCTGAGCTTCCAGTAGG + Intronic
1003981014 6:11389725-11389747 CTGGACTTTGAGGCTCCAGAGGG + Intergenic
1004542317 6:16562698-16562720 CTGGTGACTAAGACTTCAGTGGG + Intronic
1004548316 6:16621262-16621284 CTGGGCTCTGAGACTGAAGCAGG - Intronic
1006000872 6:30964164-30964186 ATGGACTCTGAGACCTCCATAGG + Intergenic
1006785700 6:36665538-36665560 CTGGTCTGGGAGACCTCAGTAGG + Intergenic
1007057990 6:38907302-38907324 CTGGACTCTGAATCTCAAGTGGG - Intronic
1007193086 6:40036604-40036626 CTGGACACTCAGACTTGAGGTGG - Intergenic
1007311303 6:40948018-40948040 CTGCACTCTGAGACTAGACTGGG + Intergenic
1009349921 6:62661462-62661484 CTGAACTCAGAGAGTTCAGCTGG - Intergenic
1012187448 6:96237033-96237055 CTGGAGACTGAGAGGTCAGTAGG - Intergenic
1012943695 6:105443540-105443562 CTGGACTCTGAGTGTTAAGTAGG - Intergenic
1015186319 6:130420591-130420613 CGGGAATATGTGACTTCAGTTGG + Intronic
1015927565 6:138325479-138325501 CTGGCCACGGAGGCTTCAGTGGG - Intronic
1019975785 7:4580140-4580162 CTGGACTCAGGGACTGCAGATGG - Intergenic
1022856395 7:34319027-34319049 CAGGACTCTAAGATTTCAATGGG - Intergenic
1023620399 7:42066201-42066223 GAGTACACTGAGACTTCAGTGGG + Intronic
1024142635 7:46477735-46477757 AAGGACTTTGAGGCTTCAGTGGG + Intergenic
1026246679 7:68626509-68626531 CAGGAGTTTGAGACTGCAGTGGG + Intergenic
1029210161 7:98901358-98901380 CTGGACACAGAGTCTTCAGGAGG - Intronic
1030748906 7:113205223-113205245 CTGGCCTCTGAGAGCTCAGATGG - Intergenic
1031897985 7:127374857-127374879 CTTGACTCTGTGACTTCAATAGG + Exonic
1034267545 7:149788548-149788570 CTGCACTCTGTGACCTCAGGAGG + Intergenic
1036671995 8:10796264-10796286 CTGGAGTCTTTGACTTCAGATGG - Intronic
1036970538 8:13349938-13349960 CTGGTCTCAGAGACTGAAGTCGG - Intronic
1037595231 8:20349237-20349259 CTGAACTCTGAGAATTGAGCAGG - Intergenic
1038970732 8:32631529-32631551 ATGAACTCTTAGACTTTAGTAGG + Intronic
1040372933 8:46794903-46794925 CTGGACTCTGGAATTCCAGTTGG - Intergenic
1042206650 8:66336295-66336317 ATTGATTCTGAGACTTCTGTGGG - Intergenic
1043881934 8:85553806-85553828 TTGGAATCTTAGACTTCATTAGG - Intergenic
1045738776 8:105328889-105328911 CTGTACACTGAGTCTTCATTTGG - Intronic
1047387166 8:124420958-124420980 CAGGACTTTGAGGCTGCAGTGGG - Intergenic
1049221521 8:141430834-141430856 CTGGAATCTGAGAGTGCAGTGGG - Intronic
1049258811 8:141627924-141627946 CTTGGCTCTGAGACTGCAGGAGG + Intergenic
1050327925 9:4515695-4515717 CTGCAGTCTGAGACTTCTCTGGG + Intronic
1050453247 9:5806499-5806521 CAGGAGGCTGAGACTGCAGTGGG - Intronic
1051549335 9:18311748-18311770 CAGGACTCTCACAGTTCAGTGGG + Intergenic
1051700189 9:19814145-19814167 CTGGACAATGAGATATCAGTGGG - Intergenic
1051821488 9:21174722-21174744 CTGAGCTCTGAGCCTTCATTTGG - Intergenic
1052835412 9:33246508-33246530 CTTGACTCTGATACCTCACTGGG + Intronic
1055081620 9:72273334-72273356 CTGGATCCGAAGACTTCAGTGGG - Intergenic
1059764638 9:117372134-117372156 CTGGCCTCGGGGACTGCAGTCGG - Intronic
1059992786 9:119881054-119881076 CAGGACTCTGAGATCTCAGAAGG + Intergenic
1060842699 9:126805989-126806011 CTGCACTCTGACACTTATGTTGG - Intronic
1060867477 9:127011510-127011532 TGGGACTCTTAGAATTCAGTAGG + Intronic
1186627585 X:11310987-11311009 ATGGACTCTCACAGTTCAGTGGG + Intronic
1186789127 X:12980096-12980118 CTGGCTTCTGAGACTTTTGTAGG + Intergenic
1189193588 X:39133176-39133198 CTGGACTCTGTGACTTATTTAGG + Intergenic
1189410613 X:40767649-40767671 CAGGACTTTGAGGCTGCAGTGGG - Intergenic
1189835338 X:45015173-45015195 CGGGAGGTTGAGACTTCAGTGGG - Intronic
1190242312 X:48666957-48666979 CAGGAGTCTGAGACTACAGTAGG + Intergenic
1190496400 X:51031895-51031917 CTGGACACTGAGACTGTACTTGG + Intergenic
1190509569 X:51162050-51162072 CTGGACACTGAGACTGTACTTGG - Intergenic
1192259717 X:69497937-69497959 CTGGAATCTGAGTATTAAGTAGG + Intergenic
1195302536 X:103544705-103544727 CTGGTGTCTGAGTCATCAGTGGG - Intergenic
1198052383 X:132961435-132961457 CTGTAATCTGAGACAACAGTGGG + Intergenic
1198265180 X:135002181-135002203 GTAGACTATGAGGCTTCAGTGGG - Intergenic
1200084400 X:153596343-153596365 CTGGGCTCTCAGACTCTAGTGGG + Intronic
1202266826 Y:23028348-23028370 CTGGACTCTGGAATTCCAGTTGG - Intergenic
1202419819 Y:24662093-24662115 CTGGACTCTGGAATTCCAGTTGG - Intergenic
1202450967 Y:25007991-25008013 CTGGACTCTGGAATTCCAGTTGG + Intergenic