ID: 1120795939

View in Genome Browser
Species Human (GRCh38)
Location 14:88632834-88632856
Sequence CTGGACTCTGAGACTTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120795937_1120795939 -10 Left 1120795937 14:88632821-88632843 CCCAATAAAAACTCTGGACTCTG 0: 2
1: 12
2: 77
3: 274
4: 959
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223
1120795932_1120795939 5 Left 1120795932 14:88632806-88632828 CCTATGTGACCAACCCCCAATAA 0: 2
1: 7
2: 28
3: 103
4: 261
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223
1120795933_1120795939 -4 Left 1120795933 14:88632815-88632837 CCAACCCCCAATAAAAACTCTGG 0: 2
1: 3
2: 32
3: 88
4: 309
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223
1120795935_1120795939 -8 Left 1120795935 14:88632819-88632841 CCCCCAATAAAAACTCTGGACTC 0: 1
1: 10
2: 32
3: 75
4: 311
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223
1120795936_1120795939 -9 Left 1120795936 14:88632820-88632842 CCCCAATAAAAACTCTGGACTCT 0: 1
1: 12
2: 82
3: 191
4: 636
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223
1120795931_1120795939 6 Left 1120795931 14:88632805-88632827 CCCTATGTGACCAACCCCCAATA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG 0: 1
1: 0
2: 1
3: 28
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120795939 Original CRISPR CTGGACTCTGAGACTTCAGT AGG Intronic