ID: 1120799693

View in Genome Browser
Species Human (GRCh38)
Location 14:88674839-88674861
Sequence ATAATACAGCTGTCCCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 13, 3: 160, 4: 473}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120799690_1120799693 6 Left 1120799690 14:88674810-88674832 CCTAGATACAATGGGGGTACAGG 0: 735
1: 1597
2: 1800
3: 1346
4: 982
Right 1120799693 14:88674839-88674861 ATAATACAGCTGTCCCAAATAGG 0: 1
1: 0
2: 13
3: 160
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120799693 Original CRISPR ATAATACAGCTGTCCCAAAT AGG Intronic
902783680 1:18719786-18719808 GTGAAACAGCTGTCCCAACTGGG + Intronic
903146586 1:21376632-21376654 TAAATACAGCTGTTCCAAAGGGG - Intergenic
903645243 1:24891713-24891735 TAAATACAGCTGTTCCAAATGGG + Intergenic
904852266 1:33468023-33468045 ATGCTGCAGCTGTCCCAAACAGG + Intergenic
905184829 1:36188692-36188714 CTAATACGGCTGTCCCAAAGTGG - Intergenic
905494859 1:38376986-38377008 AAAATACAGGTGTGCCAGATGGG - Intergenic
905784864 1:40746865-40746887 ATAACACAGCTGTTCCTAAAAGG + Intronic
906373019 1:45270366-45270388 TAAATACAGCTGTTCCAAATGGG - Intronic
907392116 1:54164988-54165010 TAAATACAGGTGTTCCAAATGGG + Intronic
907685711 1:56609380-56609402 TAAATACAGCCATCCCAAATGGG + Intronic
908729290 1:67209104-67209126 GTAATACAGCCATTCCAAATGGG - Intronic
909646123 1:77919496-77919518 TAAATACAGCAGTTCCAAATGGG + Intronic
909681348 1:78295074-78295096 TAAATACAGCTGTTCCAAATGGG - Intergenic
910064934 1:83141498-83141520 TAAATACACCTGTTCCAAATGGG - Intergenic
910628991 1:89337644-89337666 TAAGTACAGCTGTTCCAAATGGG - Intergenic
910649115 1:89545747-89545769 ATAAGACAGATGTCCCAAGAAGG + Intronic
910706818 1:90139329-90139351 TAAATACAGCCGTACCAAATGGG + Intergenic
910708323 1:90153423-90153445 TAAATACAGCTGTTCCAAATGGG + Intergenic
910774446 1:90861424-90861446 TAAATACACCTGTTCCAAATGGG + Intergenic
911020457 1:93381828-93381850 TTAAAACACCTGGCCCAAATGGG - Intergenic
911358577 1:96849690-96849712 TAAATACAGCTGTTCCAAATGGG - Intergenic
911686178 1:100780245-100780267 TAAATACAGATGTTCCAAATAGG + Intergenic
912002980 1:104857918-104857940 TAAATACACCTGTTCCAAATAGG + Intergenic
912068739 1:105780138-105780160 TAAATACACCTGTTCCAAATGGG - Intergenic
912098885 1:106181311-106181333 ATAATACAGGTGGGCCAAGTGGG + Intergenic
912121767 1:106480013-106480035 TAAATACAGCTGTTCCAAATGGG - Intergenic
912222982 1:107699242-107699264 TAAATACACCTGTTCCAAATGGG + Intronic
912327731 1:108784797-108784819 TAAATACACCTGTTCCAAATGGG + Intronic
913254119 1:116938856-116938878 TGAATACAGCTATTCCAAATGGG + Intronic
913709912 1:121472728-121472750 TAAATACACCTGTTCCAAATGGG + Intergenic
916688980 1:167172747-167172769 TAAATACAGTTGTCCCAAATGGG - Intergenic
917703669 1:177608568-177608590 ATAATACATATTTACCAAATTGG + Intergenic
918718062 1:187817636-187817658 TAAATACACCTGTTCCAAATTGG + Intergenic
918817973 1:189214630-189214652 ATATGAGAGCTGTCCCATATGGG + Intergenic
918831494 1:189404868-189404890 TAAATCCAGCTGTTCCAAATGGG + Intergenic
919256177 1:195128180-195128202 TAAATACACCTGTACCAAATGGG + Intergenic
919567411 1:199206274-199206296 ATGCTACAGCTGTCACAAATTGG + Intergenic
920698853 1:208202716-208202738 AGAATACAGGTGACCTAAATAGG - Intronic
920895843 1:210048876-210048898 TAAATACAGCTTTTCCAAATGGG + Intronic
921000670 1:211039737-211039759 TAAATGCAGCTGTTCCAAATGGG - Intronic
921496807 1:215852682-215852704 TAAATACAGCTGTTCCAAATGGG + Intronic
923197898 1:231685890-231685912 TAAATACAGCTGTTCCAAATAGG + Intronic
923297920 1:232612625-232612647 TAAATACAGCTCTTCCAAATGGG - Intergenic
923461292 1:234211637-234211659 TAAATACAGCTGTTCAAAATGGG - Intronic
924806682 1:247366941-247366963 TGAATACAGCCGTTCCAAATGGG - Intergenic
1063014623 10:2063879-2063901 TAAATACAGCTGTTCCAAATGGG + Intergenic
1063125220 10:3131034-3131056 ATAATGGAGCTGCCCCAAACAGG + Intronic
1064403188 10:15038165-15038187 TAAATACAGCAGTTCCAAATGGG - Intronic
1064840654 10:19587306-19587328 ATAATGCACCTGTTACAAATGGG - Intronic
1065580603 10:27167238-27167260 ATGCCACAGCAGTCCCAAATGGG + Exonic
1066040680 10:31545808-31545830 TAAATACAGCTGTTTCAAATGGG + Intergenic
1066310863 10:34194946-34194968 ATAAAACAGATGTGCCACATTGG + Intronic
1067665014 10:48270316-48270338 ACAAATCAGCTGTCGCAAATTGG - Intronic
1067812218 10:49438788-49438810 TAAATACAGCCGTTCCAAATGGG + Intergenic
1067956361 10:50795594-50795616 TAAATACAGCTGTTCCAAATGGG - Intronic
1067966833 10:50922979-50923001 TAAATACACCTGTTCCAAATGGG + Intergenic
1068128507 10:52869195-52869217 TAAATACACCTGTTCCAAATGGG - Intergenic
1068264352 10:54627060-54627082 AAAATACAGCCATTCCAAATGGG - Intronic
1069351436 10:67531508-67531530 TAAATACAGCTGTTACAAATGGG - Intronic
1069424591 10:68278432-68278454 TGAATACAACTGTTCCAAATGGG - Intergenic
1070651944 10:78243735-78243757 TAAATACAGCAGTTCCAAATGGG - Intergenic
1071873368 10:89818530-89818552 TAAATATAGCTGTTCCAAATGGG + Intergenic
1072837838 10:98735777-98735799 TAAATACAGCTGTTCCAAATGGG - Intronic
1073864672 10:107787783-107787805 TAAATACAGCTGTTCCAAATGGG - Intergenic
1073926187 10:108519225-108519247 TAAATACACCTGTTCCAAATGGG - Intergenic
1073994086 10:109295535-109295557 TAAATACAGCTGTTCTAAATTGG - Intergenic
1074069276 10:110049975-110049997 TAAATACAGCTGTTCCAAATGGG - Intronic
1075089298 10:119434442-119434464 TAAATACAGCTGTTCCAAATGGG + Intronic
1075442354 10:122490067-122490089 ACAAACCAGCTCTCCCAAATTGG + Intronic
1075550436 10:123388768-123388790 TAAATACAGCTGTTCCAAATGGG - Intergenic
1076759999 10:132599281-132599303 TAAATACAGCCGTTCCAAATGGG + Intronic
1077193303 11:1265295-1265317 TAAATATAGCTGTTCCAAATGGG + Intergenic
1077525740 11:3063479-3063501 TAAATACAGCTGTTTCAAATGGG - Intergenic
1077884990 11:6380813-6380835 ATAATACAACTGTTACAAAATGG + Intergenic
1078686696 11:13538653-13538675 CAAATACACCTGTTCCAAATGGG - Intergenic
1078712866 11:13812445-13812467 TAAATACAGCTGTTCCAAATTGG + Intergenic
1079049892 11:17145002-17145024 TAAATACAGCCGTTCCAAATGGG - Intronic
1079586098 11:22128292-22128314 TAAATACAGCTGTTCCAAATGGG + Intergenic
1079721170 11:23816527-23816549 TAAATACAGCTGTTCCAAATGGG + Intergenic
1079945282 11:26733527-26733549 TAAATACAGCCGTTCCAAATGGG - Intergenic
1080204823 11:29716723-29716745 TAAATACAGCCATCCCAAATGGG + Intergenic
1080341684 11:31272561-31272583 TAAATACAGTTGTTCCAAATGGG + Intronic
1080477374 11:32608351-32608373 TAAACACAGCTGTTCCAAATGGG + Intronic
1080717503 11:34818449-34818471 TAAATACAGCTCTTCCAAATGGG + Intergenic
1080904074 11:36522921-36522943 TAAATACACCTGTTCCAAATGGG - Intronic
1081008066 11:37773536-37773558 TAAATACAGCTGTTTCAAATGGG + Intergenic
1081038012 11:38174416-38174438 ATAATGCAGCTGCCCTAAATAGG - Intergenic
1081400453 11:42636516-42636538 TAAATACAGCTGTTCCTAATGGG - Intergenic
1083122538 11:60529439-60529461 AATATACAGCTGTTCCAATTTGG + Exonic
1085374748 11:76049548-76049570 ATAATACAGCTTTACAAAATGGG + Intronic
1086794632 11:91084562-91084584 TAAATACAGCTCTTCCAAATGGG - Intergenic
1087140685 11:94762733-94762755 AAAATGCACCTGTACCAAATGGG - Intronic
1087793726 11:102433440-102433462 TAAATACACCTGTTCCAAATGGG - Intronic
1087908195 11:103724051-103724073 TAAATACACCTGTTCCAAATGGG + Intergenic
1088166053 11:106938808-106938830 ATAATCCAGATTTCCCAAAGGGG + Intronic
1088487888 11:110358671-110358693 ATAATACAACTAACACAAATTGG - Intergenic
1088924169 11:114283948-114283970 ATAGGACAGATGTCCTAAATAGG + Intronic
1090692678 11:129200067-129200089 TAAATACAGCTGTTCCAAATGGG - Intronic
1091630956 12:2160567-2160589 AAAATACAGGTGTCCCTAAGAGG + Intronic
1091932201 12:4404957-4404979 TAAATACAGCTGTTCCGAATGGG - Intergenic
1092642954 12:10537250-10537272 TAAATACAGCTGTTCCAAATAGG + Intergenic
1093141761 12:15517633-15517655 TTGACACAGCTGTTCCAAATGGG + Intronic
1093230468 12:16537127-16537149 TAAATACAGCTGTTCCAAATGGG + Intronic
1093297257 12:17405645-17405667 TTAATACAGCCATTCCAAATGGG - Intergenic
1093300133 12:17443316-17443338 TTAATACAGCCATTCCAAATGGG - Intergenic
1093682982 12:22024090-22024112 TAAATACAGCTGTTCCAAATGGG - Intergenic
1093692750 12:22125873-22125895 GTAATACAGCTGTTCCAAATGGG - Intronic
1093899048 12:24608612-24608634 ATAAAACAGCAGTAACAAATTGG - Intergenic
1093977244 12:25437037-25437059 ATAATACAGTTGTTCCAAAATGG - Intronic
1094295348 12:28898965-28898987 TAAATGCAGCTGTTCCAAATGGG - Intergenic
1094706143 12:32916028-32916050 TAAATACAGCTGTTCCAAATGGG - Intergenic
1094785698 12:33846292-33846314 TAAATACAGCTGTTCCAAATGGG + Intergenic
1095491637 12:42740618-42740640 ATAATTCAGCAGTCCCATTTTGG + Intergenic
1095544064 12:43344556-43344578 TAAATACACCTGTTCCAAATGGG + Intergenic
1096441702 12:51649021-51649043 TAAATACAGCTGTTCCAAATGGG + Intronic
1096935526 12:55269342-55269364 TAAATACAGCTGCTCCAAATGGG - Intergenic
1098676429 12:73294888-73294910 TAAATACAGCTGTTCCAAATAGG - Intergenic
1098741486 12:74178729-74178751 TAAATACACCTGTTCCAAATGGG + Intergenic
1098795799 12:74887394-74887416 TAAATACAGCAGTTCCAAATGGG + Intergenic
1098926800 12:76360197-76360219 TAAATACAACTGTTCCAAATGGG + Intronic
1099621364 12:85005993-85006015 TAAATACACCTGTTCCAAATGGG - Intergenic
1099700146 12:86073703-86073725 TAAATGCAGCTGTTCCAAATGGG - Intronic
1099722681 12:86383652-86383674 TAAATACAGTTGTTCCAAATGGG - Intronic
1099780161 12:87183635-87183657 TAAATACAGCTGTTCTAAATGGG - Intergenic
1099838575 12:87937764-87937786 TAAATACACCTGTTCCAAATGGG - Intergenic
1100020671 12:90065834-90065856 ATAATACTGCTTTACTAAATTGG - Intergenic
1100086168 12:90913581-90913603 CAAATACACCTGTTCCAAATGGG + Intronic
1100205575 12:92345564-92345586 TAAATACAGCAGTTCCAAATGGG - Intergenic
1100292279 12:93228817-93228839 ATATTAAATCAGTCCCAAATGGG + Intergenic
1100434174 12:94556559-94556581 ATAATACAGCTGTCAGAATCAGG - Intergenic
1100898874 12:99215704-99215726 TAAATACACCTGTTCCAAATTGG - Intronic
1100972046 12:100080590-100080612 TAAATACAGCTATTCCAAATGGG - Intronic
1101222678 12:102657564-102657586 TAAATACAGCTGTTCTAAATGGG + Intergenic
1101648299 12:106651913-106651935 ATAAGACAGCTTTCTCAAACTGG - Intronic
1102148801 12:110674257-110674279 TAAATACAGCTGTTCCTAATGGG - Intronic
1102248793 12:111371832-111371854 TAAATACAGCCGTTCCAAATGGG + Intergenic
1103114148 12:118310529-118310551 ATATTACATCTGTTCCAAACTGG + Intronic
1103880690 12:124163759-124163781 TAAATACAGCTGTTACAAATGGG + Intronic
1104543165 12:129685953-129685975 TAAATACACCTGTTCCAAATGGG - Intronic
1104679438 12:130739354-130739376 ATAATCCAGCTGTGCCAGTTAGG - Intergenic
1106231257 13:27823009-27823031 TTATTTCAGCTGTGCCAAATGGG - Intergenic
1106262223 13:28077842-28077864 TAAATACAGCTGTTCCAAATGGG + Intronic
1106813751 13:33385346-33385368 TTAGGACAGCTGTACCAAATAGG - Intergenic
1108603791 13:52017166-52017188 TAAGTACAGCTGTTCCAAATGGG - Intronic
1108790767 13:53966807-53966829 TAAATACAGCAGTTCCAAATGGG - Intergenic
1108936706 13:55890987-55891009 TAAATACAGCCGTTCCAAATGGG + Intergenic
1109286089 13:60409646-60409668 TAAATACAGCTGTTCCAAATGGG - Intronic
1109480333 13:62944697-62944719 TAAATACAGCTATTCCAAATGGG + Intergenic
1109946535 13:69441303-69441325 AAAATACAGCTTTGCTAAATAGG + Intergenic
1110377932 13:74814915-74814937 TAAATACAGCTATTCCAAATGGG - Intergenic
1110955268 13:81546072-81546094 TAAATACATCTGTTCCAAATGGG + Intergenic
1110970721 13:81757984-81758006 TAAATACACCTGTACCAAATGGG + Intergenic
1111081856 13:83321700-83321722 TAAATACATCTGTTCCAAATGGG + Intergenic
1111334330 13:86801132-86801154 TAAATATAGCTGTTCCAAATGGG - Intergenic
1111336766 13:86836064-86836086 AAAATACAGCTGTTCCAACTGGG + Intergenic
1111394632 13:87649050-87649072 AGAAAACTGCTTTCCCAAATAGG + Intergenic
1111471969 13:88695311-88695333 TTAATACAGCCATTCCAAATCGG + Intergenic
1111687146 13:91516321-91516343 TAAATACAGCTGTTCCAAATGGG + Intronic
1111819389 13:93194558-93194580 TGAATACAGCTGTTACAAATGGG - Intergenic
1112799243 13:103092498-103092520 CAAATACAGCTGTTCCAAATGGG + Intergenic
1112855748 13:103767973-103767995 TAAATACACCTGTTCCAAATGGG + Intergenic
1112887688 13:104194044-104194066 TAAATACAGCTGTTCCAAATGGG - Intergenic
1112971781 13:105270716-105270738 TAAATACAGCCGTTCCAAATGGG - Intergenic
1114175162 14:20311706-20311728 ATAATACACCTGTTCGAAATCGG - Exonic
1114871537 14:26665354-26665376 TAAGTACAGCTGTTCCAAATGGG + Intergenic
1114986023 14:28230255-28230277 TAAATACAGCTGTTCCAAATGGG + Intergenic
1115007070 14:28498763-28498785 TAAATATAGCTGTTCCAAATGGG + Intergenic
1115009167 14:28523028-28523050 TAAATACACCTGTTCCAAATGGG - Intergenic
1115298388 14:31856632-31856654 TAAATACAGCTGTTCTAAATGGG + Intronic
1115404245 14:32997183-32997205 TAAATACAGCTATTCCAAATGGG - Intronic
1116080336 14:40163004-40163026 TCAATACATCTGTTCCAAATGGG - Intergenic
1116120606 14:40717954-40717976 TAAATACAGCTGTTCCAAATGGG - Intergenic
1116126968 14:40800561-40800583 TAAATACAGCTGTTCCAAATGGG + Intergenic
1116133460 14:40890783-40890805 TAAATATAGCTGTTCCAAATGGG + Intergenic
1116154398 14:41185490-41185512 TAAATATAGCTGTTCCAAATGGG + Intergenic
1116164253 14:41312417-41312439 TAAATACAGCTGTTCCAAATGGG - Intergenic
1116275321 14:42824895-42824917 TAAATACAGCTGTTCCAAATGGG - Intergenic
1116389542 14:44376529-44376551 TAAATACAGCTATTCCAAATGGG + Intergenic
1116415448 14:44672302-44672324 TAAATACACCTGTTCCAAATGGG + Intergenic
1116495979 14:45560730-45560752 ATGACACAGCTGTCCCACCTGGG - Intergenic
1117647962 14:57872306-57872328 ATAATACAGAGGTACCAAAGTGG + Intronic
1118213955 14:63790533-63790555 ACAATACAGCTGTCTCCATTTGG + Intergenic
1118239695 14:64044321-64044343 TAAATTCAGCTGTTCCAAATGGG - Intronic
1118496016 14:66308751-66308773 TAAATACAGCTATTCCAAATGGG + Intergenic
1120166731 14:81208867-81208889 TAAATAAAGCTGTTCCAAATGGG - Intronic
1120481352 14:85053658-85053680 TAAATACACCTGTTCCAAATGGG + Intergenic
1120799693 14:88674839-88674861 ATAATACAGCTGTCCCAAATAGG + Intronic
1121128913 14:91427741-91427763 TAAATACACCTGTTCCAAATGGG - Intergenic
1121483752 14:94297888-94297910 TAAATACGGCTGTTCCAAATGGG + Intergenic
1124009134 15:25821794-25821816 AAACTACAGCTATGCCAAATTGG + Intronic
1124695741 15:31862969-31862991 GTAATACAGCCATTCCAAATGGG + Intronic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1125339399 15:38659991-38660013 ATAATACAGCTCCCCCAAAATGG - Intergenic
1126399739 15:48257033-48257055 TAAATACACCTGTTCCAAATGGG + Intronic
1126514367 15:49519011-49519033 TAAATACACCTGTTCCAAATGGG + Intronic
1126539238 15:49803931-49803953 TAAATACAGCTGTTCCAAATGGG + Intergenic
1128176997 15:65564980-65565002 TAAATACAGCCGTTCCAAATGGG + Intronic
1128688754 15:69707262-69707284 TAAATACAGCTGTTCCAAATGGG + Intergenic
1129469541 15:75743173-75743195 TAAATACAGTTGTTCCAAATGGG - Intergenic
1130409246 15:83631029-83631051 TAAATACACCTGTTCCAAATGGG + Intergenic
1131722541 15:95186547-95186569 ATAATACAGCAAAACCAAATTGG + Intergenic
1133683478 16:8143463-8143485 AAAATAAAGCTGTGCCAACTGGG + Intergenic
1134221203 16:12355719-12355741 AGCTTACAGCTGGCCCAAATGGG + Intronic
1135918959 16:26631304-26631326 TAAATACAGCTGTTCCAAATGGG + Intergenic
1137544728 16:49394562-49394584 ATAAAACATGTATCCCAAATAGG + Intronic
1137918698 16:52462927-52462949 ATAAGATTGCTTTCCCAAATAGG - Intronic
1138355823 16:56379657-56379679 TAAATACAGCTGTTCCAAATGGG + Intronic
1139812683 16:69636067-69636089 TAAATACAGCTGTTCCAAATGGG + Intronic
1141037727 16:80643121-80643143 TAAATACAGCTATTCCAAATGGG + Intronic
1141317911 16:82979142-82979164 TAAATACATCTGTTCCAAATGGG - Intronic
1143210763 17:5185745-5185767 TAAATACAGCTGTTCCAAATGGG + Intronic
1144538441 17:16114580-16114602 TAAATACAGCTGTTCCAAGTGGG + Intronic
1145378093 17:22370477-22370499 AAAATACAGCTGTTCCAAATGGG + Intergenic
1147416122 17:40291499-40291521 TGAACACAGCTGTCCCAGATCGG + Exonic
1147834284 17:43318966-43318988 TAAATACAGCTGTTCAAAATGGG + Intergenic
1148640838 17:49185964-49185986 TAAATACAGCTGTTTCAAATGGG - Intergenic
1149113596 17:53063750-53063772 TAAATACACCTGTTCCAAATGGG - Intergenic
1149159048 17:53668189-53668211 TAAATACACCTGCCCCAAATGGG - Intergenic
1149452307 17:56759268-56759290 TAAATACAGCTGTTCCAAATGGG - Intergenic
1151135918 17:71945593-71945615 AAAATACAGCCATTCCAAATAGG - Intergenic
1153454937 18:5270844-5270866 TAAATATAGCTGTTCCAAATGGG + Intergenic
1153538985 18:6134546-6134568 TAAATACAGCTGTTCCAAATGGG + Intronic
1154313070 18:13282441-13282463 TAAATACAGCTGTTACAAATGGG + Intronic
1155632049 18:27905713-27905735 TAAATACAGCTGTTCCAAATGGG + Intergenic
1156153143 18:34266919-34266941 TAAATACAGCTGTTCCAAATGGG - Intergenic
1156437669 18:37150646-37150668 ATAATACAGCTTGACTAAATAGG + Intronic
1157377915 18:47182901-47182923 TAAATACAGCTGTTCCAAATGGG - Intergenic
1158020516 18:52836478-52836500 TAAATACACCTGTTCCAAATGGG + Intronic
1158071518 18:53476084-53476106 TAAATACAGCCGTTCCAAATGGG - Intronic
1159282835 18:66309979-66310001 TAAATACACCTGTTCCAAATGGG + Intergenic
1159433431 18:68384819-68384841 AAAATACAGCTGTTTCAAATGGG - Intergenic
1159575317 18:70168942-70168964 AGAATTCAGCTGTTCCAAATAGG + Exonic
1159731563 18:72034179-72034201 TAAATACAGCTGTTGCAAATGGG + Intergenic
1159962325 18:74565496-74565518 TAAATATAGCTGTTCCAAATGGG + Intronic
1165974700 19:39665620-39665642 TAAATACAGCTGTTCCAAATGGG + Intergenic
1166629215 19:44390450-44390472 TAAATACAGCTGTTCCAAATGGG - Intronic
1166638049 19:44469356-44469378 TAAATACAGCTGTTCCAAATGGG + Intergenic
1168496300 19:56854355-56854377 TAAATATAGCTGTTCCAAATGGG - Intergenic
925455984 2:4017089-4017111 TAAATACAGCTATTCCAAATGGG + Intergenic
926392034 2:12403349-12403371 TAAATACACCTGTTCCAAATGGG - Intergenic
926947523 2:18204039-18204061 TAAATACAGTTGTTCCAAATGGG - Intronic
927030501 2:19116431-19116453 AAAATACATCTGTTCCAAATGGG + Intergenic
927126959 2:20020911-20020933 TAAATACACCTGTGCCAAATGGG + Intergenic
927288185 2:21378692-21378714 TAAATACAGCTGTTCCAAATGGG + Intergenic
927341826 2:21991868-21991890 AAAATACAGCTATTCCAAATGGG + Intergenic
928711529 2:34011945-34011967 ACAAAACATCTGTCTCAAATTGG + Intergenic
929528752 2:42731891-42731913 TAAATACAGCCGTTCCAAATGGG + Intronic
930444382 2:51451629-51451651 TAAATACAGCTGTTCCAAATGGG - Intergenic
933350304 2:81145371-81145393 TAAATACAGCTGTTCCAAATGGG + Intergenic
933454429 2:82502737-82502759 TAAATACAGCTCTTCCAAATGGG - Intergenic
934144240 2:89075803-89075825 TTAATACAGCTGTTCCAAATGGG - Intergenic
934225002 2:90124745-90124767 TTAATACAGCTGTTCCAAATGGG + Intergenic
935140046 2:100344936-100344958 TAAATACATCTGTTCCAAATGGG - Intergenic
935419657 2:102854146-102854168 TAAATACAGCTGTTCCAAATGGG + Intergenic
935625840 2:105171757-105171779 TAAATACAGCTGTTCCAAATGGG + Intergenic
935649665 2:105371438-105371460 ATGATACTGCAGTTCCAAATGGG - Intronic
936257623 2:110930346-110930368 TAAATACAGCTGTTCCAAATGGG - Intronic
936549873 2:113427802-113427824 TAAATACAGCCATCCCAAATGGG - Intergenic
936827964 2:116604489-116604511 TAAATACAGCCGTTCCAAATGGG - Intergenic
938165458 2:129021788-129021810 TAAATACAGCTGTTCCAAATGGG - Intergenic
939016990 2:136914230-136914252 TAAATACAGCTATTCCAAATGGG - Intronic
939079266 2:137639827-137639849 AAAATACAGCCATTCCAAATGGG - Intronic
939155799 2:138523631-138523653 TAAATATAGCTGTTCCAAATGGG + Intronic
939498202 2:142948978-142949000 TAAATACAGCTGTTCAAAATGGG + Intronic
939575331 2:143888350-143888372 ATAATACAGTTGTTCCTAATTGG - Intergenic
939578165 2:143920129-143920151 TAAATACAGCTGTTCCAAATGGG - Intergenic
940485173 2:154288586-154288608 AAAATACGGCTGTTCCAAATAGG + Intronic
941137346 2:161733969-161733991 TAAATACAGCTGTTCCAAATGGG - Intronic
941335597 2:164240338-164240360 TAAATACAGTTGTTCCAAATGGG + Intergenic
941649899 2:168081431-168081453 TAAATACAGCTGTTCCAAATGGG - Intronic
942518010 2:176773648-176773670 TAAATACAGCTGTTCAAAATCGG - Intergenic
943004672 2:182375370-182375392 TAAATAGAGCTGTTCCAAATGGG + Intronic
943245905 2:185450861-185450883 TAAATACAGCTTTTCCAAATGGG + Intergenic
943386785 2:187211099-187211121 AAAATACAGCCGTTCCTAATGGG - Intergenic
943406345 2:187492737-187492759 TAAATACAGCTGTTCCAAATGGG - Intronic
943622664 2:190167624-190167646 TAAATACAGCTGTTCCAAATTGG + Intronic
943776837 2:191774870-191774892 AAAATACAGCCATTCCAAATGGG - Intergenic
943832981 2:192485778-192485800 TAAATACAGCTTTTCCAAATGGG - Intergenic
944272119 2:197795897-197795919 TAAATACACCTGTTCCAAATGGG + Intergenic
944827905 2:203503815-203503837 TAAATACAGCCGTTCCAAATGGG + Intronic
945073754 2:206016350-206016372 TAAATACAGCTGTTCCAAATGGG - Intronic
945644156 2:212468057-212468079 TAAATACAGCCATCCCAAATGGG - Intronic
945759973 2:213902865-213902887 TAAATACTGCTGTTCCAAATGGG + Intronic
947236873 2:227950170-227950192 TAAATACAGCTGTTCCAAATAGG - Intergenic
1169593875 20:7176410-7176432 TAAATACAGCTGTTCCAAATGGG + Intergenic
1169766500 20:9153046-9153068 TAAATACAGCTGTTCCAAATAGG - Intronic
1170499544 20:16960776-16960798 GGAATACAGCTCTTCCAAATGGG + Intergenic
1171525177 20:25803529-25803551 TAAATACAGCTGTTCCAAATGGG - Intronic
1171534367 20:25873183-25873205 TAAACACAGCTGTTCCAAATGGG - Intergenic
1171551650 20:26052355-26052377 TAAATACAGCTGTTCCAAATGGG + Intergenic
1171792770 20:29543658-29543680 TAAATACAGCTGTTCCAAATGGG + Intergenic
1175255731 20:57645823-57645845 TAAATACAGCTGTTCCAAATGGG - Intergenic
1176315388 21:5237661-5237683 TAAATACATCTGTTCCAAATGGG - Intergenic
1176657628 21:9602124-9602146 TAAATACAGCTGTTACAAATGGG + Intergenic
1176948103 21:15008735-15008757 ATAATACAGCAGTCCTCAAAGGG + Intronic
1177068025 21:16464551-16464573 TAAATACAGCTGTTCCAAATGGG - Intergenic
1177204767 21:17998107-17998129 TAAATAGAGCTGTTCCAAATGGG + Intronic
1177334738 21:19708277-19708299 TAAATACAGCTGTCCCAAATGGG - Intergenic
1177471203 21:21563267-21563289 TAAATACAGCTATTCCAAATGGG + Intergenic
1177479541 21:21669108-21669130 TAAATACACCTGTTCCAAATGGG + Intergenic
1177504218 21:22000253-22000275 TAAATACAGCTATTCCAAATGGG + Intergenic
1177554600 21:22672780-22672802 TAAATACAGCTGTTCCAAATGGG - Intergenic
1177761111 21:25402916-25402938 TAAATATACCTGTCCCAAATTGG - Intergenic
1177839369 21:26218767-26218789 TAAACACAGCTGTTCCAAATGGG - Intergenic
1177918643 21:27123603-27123625 TAAATACACCTGTTCCAAATGGG + Intergenic
1178052123 21:28759363-28759385 GAAATACAGCTGTTCCAAATGGG - Intergenic
1180573745 22:16753083-16753105 TAAATGCAGCTGTTCCAAATGGG - Intergenic
1181767213 22:25100458-25100480 ATAATCCAGCTGACACAAATGGG + Intronic
1184442842 22:44528925-44528947 TTAATACAGCTGGCCCATTTCGG + Intergenic
1185293237 22:50039004-50039026 ATAATACATCAGAACCAAATGGG - Intronic
949635890 3:5981211-5981233 TAAATACAGCTATTCCAAATGGG + Intergenic
950129726 3:10533887-10533909 ATAATACACATGTCCCCAATAGG + Intronic
951199628 3:19862714-19862736 TAAATACAACTGTTCCAAATGGG + Intergenic
951865217 3:27299852-27299874 TAAATACAGCTGTTCCAAATGGG - Intronic
952141233 3:30480982-30481004 TAAATACACCTGTTCCAAATGGG - Intergenic
952296447 3:32066717-32066739 ACAATACAACTGTCCAGAATTGG - Intronic
952401297 3:32966420-32966442 TAAATACAGCTGCTCCAAATGGG - Intergenic
952435165 3:33266593-33266615 TAAATACAGCTGCTCCAAATGGG + Intergenic
954591654 3:51788418-51788440 TAAATACAGCTGTTCCAGATGGG - Intergenic
956306488 3:67832120-67832142 TAAATACAGCTGTTCCAAATGGG - Intergenic
956503340 3:69910741-69910763 TAAATACAGCTGTTCCAAATGGG - Intronic
956551281 3:70462150-70462172 TAAATACAGCTGTTCCAAATGGG - Intergenic
957113256 3:75992947-75992969 TAAATACAGCTGTTTCAAATGGG - Intronic
957267135 3:77982354-77982376 TAAATACAGCTGTTCCAAATGGG + Intergenic
957470707 3:80654208-80654230 TAAATACAGCTGTTCCAAATGGG - Intergenic
957474338 3:80704792-80704814 TAAATACACCTGTTCCAAATGGG + Intergenic
957630436 3:82710741-82710763 TAAATACAGCTATTCCAAATGGG + Intergenic
957693059 3:83596763-83596785 AAAATACAGCTGTTCCAAATGGG - Intergenic
957736893 3:84214897-84214919 TAAATACAGCTGTTCCAAATAGG + Intergenic
957757600 3:84510408-84510430 CAAATACATCTGTTCCAAATGGG - Intergenic
957805012 3:85134844-85134866 GTATTACAGATATCCCAAATGGG + Intronic
957857358 3:85895385-85895407 TAAATACACCTGTTCCAAATGGG - Intronic
958042683 3:88245242-88245264 TAAATACAGCTGTTTCAAATGGG - Intergenic
958050218 3:88335309-88335331 TAAATACAGCTGTTCCAAATGGG + Intergenic
958057241 3:88428218-88428240 TAAATACAGCCGTTCCAAATGGG - Intergenic
958451146 3:94274050-94274072 ATTGTACAGCTGTACAAAATAGG + Intergenic
958637542 3:96763973-96763995 TAAATACAGCTATTCCAAATGGG - Intergenic
959317116 3:104822460-104822482 TAAATACAACTGTTCCAAATGGG - Intergenic
959342397 3:105148407-105148429 TAAATACAGCCGTTCCAAATAGG + Intergenic
959695595 3:109246066-109246088 TAAATACAGCTGTTCCAGATGGG + Intergenic
959754641 3:109883278-109883300 TAAATACAGCTGTTCTAAATGGG + Intergenic
960225022 3:115158421-115158443 TAAATACACCTGTTCCAAATGGG - Intergenic
960362947 3:116735870-116735892 TAAATACACCTGTTCCAAATGGG - Intronic
960473292 3:118093807-118093829 TAAATACACCTGTTCCAAATGGG - Intergenic
962509569 3:136084865-136084887 TAAATACACCTGTTCCAAATGGG - Intronic
963072748 3:141318556-141318578 TACATACAGCTGTCCCAAATGGG + Intergenic
963379210 3:144506986-144507008 TAAATACAGCTGTTCCAAATGGG + Intergenic
963422000 3:145072868-145072890 TAAATATAGCTGTCCCAAATGGG + Intergenic
963515722 3:146306010-146306032 TGAATACATCTGTTCCAAATGGG + Intergenic
963816563 3:149837981-149838003 TAAATACAGCTGTTCCAAGTGGG + Intronic
964508627 3:157425595-157425617 TAAATACAGCTGTTCCAAATGGG - Intronic
964520603 3:157562977-157562999 TAAATACGGCTGTTCCAAATGGG + Intronic
965086828 3:164111364-164111386 AAAATACAGCCATTCCAAATGGG + Intergenic
965198546 3:165628844-165628866 TAAATACAGCTATTCCAAATGGG + Intergenic
965989664 3:174800938-174800960 TAAATACAGCTGTTCCAAATGGG - Intronic
966299512 3:178462479-178462501 TAAATACAGCTGTTTCAAATGGG - Intronic
966325172 3:178745717-178745739 TAAATACAGCCATCCCAAATGGG + Intronic
966446485 3:180007157-180007179 TAAATACAGCTGTTCCAAATGGG + Intronic
967586725 3:191222463-191222485 TAAATACACCTGTTCCAAATAGG - Intronic
968176005 3:196549936-196549958 TAAATACAGCTGTTCAAAATGGG - Intergenic
968392316 4:203691-203713 TAAATACAGCTGGTCCAAATGGG - Intergenic
970065139 4:12085183-12085205 AAAATACATCTGTCACTAATGGG + Intergenic
970426759 4:15953094-15953116 TAGATACAGCTGTTCCAAATGGG + Intergenic
970462099 4:16284727-16284749 TAAATACAGCTGTTCCAAACGGG - Intergenic
970763347 4:19517545-19517567 TAAAGACAGCTGTTCCAAATTGG - Intergenic
970981064 4:22097957-22097979 ATAATAGAGCTGCTCCTAATTGG - Intergenic
971600261 4:28582687-28582709 TAAATACAGCAGTTCCAAATGGG - Intergenic
971601441 4:28596425-28596447 TAAATACAGCTGTCCCAAATGGG - Intergenic
971670183 4:29546227-29546249 CAAATACAGCTGTTCCAAATGGG + Intergenic
971687381 4:29786999-29787021 TAAATACAGCTGTTCCAAATGGG + Intergenic
972749462 4:41973728-41973750 TAAATACAGCTGTTCCAAATGGG - Intergenic
973589050 4:52421972-52421994 ATAATCCAGCTGTCCAAACATGG - Intergenic
974215625 4:58842480-58842502 TGAATACAGCTTTTCCAAATGGG - Intergenic
974494871 4:62614406-62614428 TAAATAGAGCTGTTCCAAATGGG + Intergenic
974845943 4:67351357-67351379 TAAATACAGCTGTTCTAAATGGG + Intergenic
974915579 4:68174121-68174143 TAAATACAGCCGTTCCAAATGGG - Intergenic
975046305 4:69808218-69808240 TAAATACAGCTGTCCCAAATGGG - Intergenic
975186600 4:71410492-71410514 TAAATACAGCTGTTCCAAATGGG - Intronic
975350354 4:73339199-73339221 TAAATACAGTTGTTCCAAATGGG + Intergenic
975598613 4:76075488-76075510 AAAAAACAGCAGTCTCAAATTGG - Intronic
975952415 4:79789498-79789520 CAAATACACCTGTTCCAAATGGG - Intergenic
976286353 4:83375011-83375033 TAAATACAGCTGTTCAAAATGGG + Intergenic
976715724 4:88120643-88120665 TAAATACACCTGTTCCAAATGGG - Intronic
977022088 4:91771785-91771807 TAAATACAACTGTTCCAAATGGG + Intergenic
977197794 4:94083627-94083649 TAAATACAGCTATTCCAAATGGG + Intergenic
977832335 4:101608678-101608700 TAAATACAGCTGTTCCAAATGGG - Intronic
977973140 4:103233637-103233659 TAAATACAGCTATTCCAAATGGG - Intergenic
977996624 4:103503120-103503142 TAAATATAGCTGTTCCAAATGGG - Intergenic
978034566 4:103977055-103977077 GTAATACAGCTATTCCAAATGGG - Intergenic
978331013 4:107612370-107612392 TAAATACAGCCATCCCAAATGGG - Intronic
978856641 4:113401354-113401376 TAAATACAGCCATCCCAAATGGG - Intergenic
980083519 4:128368742-128368764 TAAATACAGCTGTTCCAAATGGG + Intergenic
980202855 4:129677784-129677806 TAAATACAGCTGTTCCAAATGGG - Intergenic
980299232 4:130965824-130965846 TAAATACAACTGTTCCAAATGGG - Intergenic
980509807 4:133771308-133771330 AAAATACAGTCATCCCAAATGGG + Intergenic
980532499 4:134073239-134073261 TAAATACACCTGTTCCAAATGGG + Intergenic
980641495 4:135585907-135585929 TAAATACACCTGTTCCAAATGGG - Intergenic
981120913 4:141050531-141050553 TAAATACAGCTGTTGCAAATGGG + Intronic
981207545 4:142061184-142061206 ATCATATAGCTGTCCAAAAATGG + Intronic
981308158 4:143268285-143268307 TAAATACAGCTGTCCCAAATAGG - Intergenic
981359713 4:143832100-143832122 TGAATACACCTGTTCCAAATGGG - Intergenic
981370471 4:143953174-143953196 TGAATACACCTGTTCCAAATGGG - Intergenic
981380231 4:144063098-144063120 TGAATACACCTGTTCCAAATGGG - Intergenic
981643121 4:146967761-146967783 TAAATACAGCTGTTCCAAATGGG - Intergenic
981723391 4:147823786-147823808 AAAAAACAGCTGTCCCCCATGGG + Intronic
982392821 4:154884445-154884467 TAAATAGAGCTGTTCCAAATGGG + Intergenic
983322328 4:166211200-166211222 AAAGTACGGCTGTTCCAAATGGG + Intergenic
983462996 4:168049480-168049502 TAAATACAGCTGTCCCAAATGGG - Intergenic
983785990 4:171729763-171729785 TAAATATAGCTGTTCCAAATGGG - Intergenic
983789830 4:171782966-171782988 TAAATACAGCTGTTCCAAAGGGG + Intergenic
984234807 4:177142763-177142785 TAAATACAGCTCTTCCAAATGGG - Intergenic
984416076 4:179459631-179459653 TAAATATAGCTGTTCCAAATGGG - Intergenic
984900274 4:184580333-184580355 TAAATACAGATGTTCCAAATGGG + Intergenic
985417779 4:189753961-189753983 TAAATACAGCTGTTACAAATGGG - Intergenic
985809284 5:2071144-2071166 TAAATACAGCTGTTCCAAATGGG - Intergenic
986258629 5:6123441-6123463 TAAGTACAGCTGTTCCAAATAGG + Intergenic
986983528 5:13475447-13475469 GTAATACAGCCATTCCAAATGGG - Intergenic
987252355 5:16112488-16112510 TAAATACAGCCGTTCCAAATGGG - Intronic
987254769 5:16138874-16138896 CAAATACACCTGTTCCAAATGGG - Intronic
988038699 5:25860794-25860816 ATAAAACAGCCATTCCAAATGGG + Intergenic
988150045 5:27365180-27365202 TAAATACAGCTGTTCCAAATTGG - Intergenic
988256629 5:28829088-28829110 AAAATTCAGGTGTCTCAAATGGG - Intergenic
988444147 5:31266205-31266227 TTGGTACAGATGTCCCAAATTGG - Intronic
988858471 5:35252450-35252472 TAAATACATCTGTTCCAAATGGG + Intergenic
989389265 5:40883157-40883179 TAAATACAGCAGTTCCAAATGGG - Intergenic
989695947 5:44200805-44200827 TAAATACATCTGTTCCAAATAGG - Intergenic
989731717 5:44656872-44656894 TAAATACACCTGTTCCAAATGGG - Intergenic
989966956 5:50475721-50475743 TAAATACACCTGTTCCAAATGGG - Intergenic
990108357 5:52292722-52292744 TAAATACACCTGTTCCAAATGGG + Intergenic
991119344 5:62993704-62993726 TAAATACAGCCATCCCAAATGGG + Intergenic
991609635 5:68436801-68436823 ATAAGAAATCTGTCCCAAAATGG - Intergenic
991951345 5:71949367-71949389 ATAGCAGTGCTGTCCCAAATGGG - Intergenic
993000867 5:82379438-82379460 TAAATACAGCTGTTCCAGATGGG + Intronic
993215794 5:85021403-85021425 TAAATACAGCTGTTACAAATGGG + Intergenic
993430887 5:87831073-87831095 TAAATACAGCTATTCCAAATGGG + Intergenic
993723894 5:91347352-91347374 TAAATACAGCTGTTCCAAATGGG + Intergenic
993753552 5:91700538-91700560 TAAACACAGCTGTTCCAAATGGG + Intergenic
994434231 5:99707792-99707814 TAAATACAGCTATTCCAAATGGG + Intergenic
994438973 5:99777604-99777626 ATAATTCATCTGCCCCACATAGG - Intergenic
994524285 5:100883333-100883355 TAAATACAGCCGTTCCAAATGGG - Intronic
994808339 5:104479885-104479907 TAAATACACCTGTTCCAAATAGG - Intergenic
995212141 5:109552117-109552139 TAAATACAGCTGTTCCAAATGGG - Intergenic
995333752 5:110975802-110975824 TAAATACAGCTGTTCTAAATGGG + Intergenic
995420399 5:111960288-111960310 ATACCTCAGCTGTCCCAAGTAGG + Intronic
995948135 5:117675456-117675478 ATAATACAGATATTGCAAATAGG + Intergenic
996098195 5:119421080-119421102 AAAATACACCTGTTCCAAATTGG - Intergenic
996460274 5:123733136-123733158 TAAATACAGCCATCCCAAATGGG - Intergenic
996641706 5:125762262-125762284 TAAATACAGCCATCCCAAATGGG - Intergenic
996897729 5:128504620-128504642 TAAATACACCTGTTCCAAATGGG - Intronic
997108160 5:131045427-131045449 AAAATACAGCCATTCCAAATGGG + Intergenic
998576578 5:143323811-143323833 TAAATACAGCTGTTCCAAATGGG + Intronic
999012371 5:148056675-148056697 TCAATACAGCTGTTCCAAATGGG - Intronic
999844107 5:155459444-155459466 TTATTATCGCTGTCCCAAATTGG - Intergenic
1000609693 5:163360403-163360425 TAAATACACCTGTTCCAAATGGG - Intergenic
1000676253 5:164126411-164126433 TAAATACGGCTGTTCCAAATGGG + Intergenic
1000715157 5:164633635-164633657 ATAACAAGGCTGTCCCCAATAGG - Intergenic
1000907619 5:166981524-166981546 ATAATACAGCTGCCCAGCATGGG - Intergenic
1001361600 5:171091346-171091368 TAAATACAGCCGTTCCAAATGGG - Intronic
1002630179 5:180568860-180568882 AAAATCAAGCTGTCCCAAATAGG + Intronic
1004599158 6:17130921-17130943 ATACTACAAATGTCACAAATGGG - Exonic
1005984045 6:30859492-30859514 TAAATACAGCTATTCCAAATGGG + Intergenic
1006476777 6:34260641-34260663 TAAATACAGCTGTTCCAATTGGG + Intergenic
1007186003 6:39972749-39972771 TAAATACAGCTGTTCCAAATGGG - Intergenic
1008220791 6:48851754-48851776 TAAATACACCTGTTCCAAATGGG + Intergenic
1008244997 6:49161078-49161100 TAAATAGAGCTGTTCCAAATGGG + Intergenic
1008930248 6:56931791-56931813 TAAATACAGCAGTTCCAAATGGG - Intronic
1009538583 6:64923667-64923689 TAAGTACAGCTGTTCCAAATGGG + Intronic
1009737744 6:67699995-67700017 GAAATACAGCTGTGTCAAATGGG + Intergenic
1009780230 6:68260014-68260036 TAAATACAGCTATTCCAAATGGG + Intergenic
1010146267 6:72673103-72673125 ATGGGACAGCTGTCACAAATGGG - Intronic
1010835906 6:80587109-80587131 AAAATACACCTATTCCAAATGGG - Intergenic
1010863973 6:80949454-80949476 AAAATACAGCTTTCTCTAATGGG - Intergenic
1010906905 6:81501907-81501929 TAAATACACCTGTTCCAAATGGG - Intronic
1011129847 6:84041740-84041762 TAAATACAACTGTTCCAAATGGG - Intronic
1011171030 6:84504382-84504404 TAAATACAGGTGTTCCAAATGGG - Intergenic
1011343692 6:86346267-86346289 TAAATACAGCTGTTACAAATGGG + Intergenic
1011919074 6:92548155-92548177 TAAATACAACTGTTCCAAATGGG - Intergenic
1012683289 6:102210098-102210120 TAAATACAGCTATTCCAAATGGG - Intergenic
1012756731 6:103240937-103240959 TTAATACAGCAATTCCAAATGGG - Intergenic
1013151103 6:107447411-107447433 TAAATACATCTGTTCCAAATGGG + Intronic
1013404690 6:109832220-109832242 TAAATACAGCCGTTCCAAATGGG - Intergenic
1013841452 6:114400260-114400282 ATAATACAGATGTCATAACTTGG - Intergenic
1014154249 6:118092823-118092845 TAAATACACCTGTTCCAAATGGG - Intronic
1014340584 6:120201489-120201511 ATAATACATCATTCCCAAATTGG + Intergenic
1014996119 6:128146767-128146789 ATAATAAAGTTTTGCCAAATTGG - Intronic
1015674422 6:135728666-135728688 ATTCTGCATCTGTCCCAAATGGG - Intergenic
1016477283 6:144441327-144441349 TAAATACATCTGTTCCAAATGGG + Intronic
1016621124 6:146109937-146109959 AAAATACAGCCATTCCAAATAGG - Intronic
1016649520 6:146448061-146448083 AAAATACAGCCATTCCAAATGGG + Intergenic
1017355112 6:153495599-153495621 ATAATACATCTTTGTCAAATTGG + Intergenic
1017763787 6:157591042-157591064 AAAATAAACCTGTTCCAAATGGG - Intronic
1018032137 6:159849721-159849743 TAAATACAACTGTTCCAAATGGG - Intergenic
1018489789 6:164280050-164280072 CAAATACACCTGTCCCAAATGGG - Intergenic
1018866812 6:167752844-167752866 TAAATACAGCTGTTCCAAATGGG + Intergenic
1020729761 7:11866537-11866559 TAAATACACCTGTTCCAAATGGG - Intergenic
1020780991 7:12516819-12516841 TAAATACAGCAGTTCCAAATGGG - Intergenic
1021174884 7:17439529-17439551 TAAATATAGCTGTTCCAAATAGG + Intergenic
1021197762 7:17691815-17691837 ATAATAATTCTGTCCCAATTTGG - Intergenic
1021750657 7:23795846-23795868 TAAATACACCTGTTCCAAATGGG - Intronic
1021754121 7:23834302-23834324 TAAATACACCTGTTCCAAATGGG - Intergenic
1022492802 7:30833770-30833792 AAAATGCAGCTGTTCCAAATGGG + Intronic
1022862598 7:34383390-34383412 TAAATACAGCTGTTCCAAATGGG - Intergenic
1022964207 7:35457655-35457677 TAAATATAGCTGTTCCAAATGGG + Intergenic
1023652059 7:42381626-42381648 TTAATACAACTTGCCCAAATTGG - Intergenic
1024207644 7:47177466-47177488 TAAATACAGCTATTCCAAATGGG - Intergenic
1024289879 7:47794924-47794946 TAAATACAACTGTTCCAAATGGG - Intronic
1024844040 7:53621000-53621022 TAAATACACCTGTTCCAAATGGG - Intergenic
1025285858 7:57660114-57660136 TAAATGCAGCTGTTCCAAATGGG - Intergenic
1025300296 7:57814635-57814657 TAAATACAGCTGTCCCAAATGGG + Intergenic
1026532662 7:71212817-71212839 TAAATAGAGCTGTTCCAAATGGG - Intronic
1026852197 7:73731839-73731861 AGAATACAGATGTCACAACTAGG + Intergenic
1027279175 7:76593251-76593273 TAAATACACCTGTTCCAAATGGG + Intergenic
1027798253 7:82720176-82720198 TAAATACACCTGTTCCAAATGGG + Intergenic
1027834242 7:83219765-83219787 TAAATATAGCTGTTCCAAATGGG - Intergenic
1027937918 7:84632802-84632824 TAAATACAGATGTTCCAAATGGG - Intergenic
1027961054 7:84945815-84945837 ATGATACAGCAATCCCTAATAGG + Intergenic
1028042006 7:86064343-86064365 TAAATACAGCTGTTCCAAATGGG - Intergenic
1028105630 7:86874848-86874870 ATAATCCAGCAGTCCCACACTGG + Intergenic
1028117254 7:87012939-87012961 ATGTTAAAGCTGGCCCAAATAGG + Intronic
1028143661 7:87298453-87298475 TTAATACAGCTGTTCCAAATGGG + Intergenic
1028249607 7:88525800-88525822 AAAATACAGCCATTCCAAATGGG + Intergenic
1028286682 7:89011555-89011577 TAAATACAGCTGTTCCAAATGGG + Intronic
1028404959 7:90464872-90464894 TAAATACACCTGTTCCAAATGGG - Intronic
1030559024 7:111062677-111062699 CAAATACAGCTGTTCCAAATGGG + Intronic
1030999488 7:116398261-116398283 CTAATACAGATGTCCAGAATTGG + Intronic
1031145813 7:117995619-117995641 TAAATACAGCCGTTCCAAATGGG - Intergenic
1031818851 7:126473438-126473460 TAAATACACCTGTTCCAAATGGG - Intronic
1033055051 7:138044294-138044316 ATAATCAAATTGTCCCAAATTGG + Intronic
1033730318 7:144171743-144171765 TAAATACAGCTGTTCCAAATGGG - Intergenic
1033885118 7:145934616-145934638 AAAATACACCTGTTCCAAATGGG - Intergenic
1033905111 7:146192916-146192938 TAAATACACCTGTTCCAAATGGG + Intronic
1034209227 7:149348591-149348613 TAAATACACCTGTGCCAAATGGG + Intergenic
1034320152 7:150172779-150172801 TAAATATAGCTGTTCCAAATGGG + Intergenic
1034718285 7:153263940-153263962 TAAATACACCTGTTCCAAATGGG + Intergenic
1034750969 7:153568836-153568858 TAAATACACCTGTTCCAAATGGG + Intergenic
1034772595 7:153794442-153794464 TAAATATAGCTGTTCCAAATGGG - Intergenic
1037117910 8:15247797-15247819 TAAATATAGCTGTTCCAAATAGG - Intergenic
1037214022 8:16426440-16426462 AGCATACAGCTGTTCCAAATGGG - Intronic
1038121130 8:24616579-24616601 AGAAGACAGCAGTCCCAAACTGG - Intergenic
1041339162 8:56823393-56823415 TAAATACAGCAGTTCCAAATGGG - Intergenic
1041351314 8:56950634-56950656 TAAATACAGCTGTTCCAAATGGG + Intergenic
1043062047 8:75517481-75517503 TAAATACACCTGTTCCAAATGGG + Intronic
1043241147 8:77937539-77937561 TAAATACAGCTGTTCCAAATGGG + Intergenic
1043345897 8:79297263-79297285 TAAATACACCTGTTCCAAATGGG - Intergenic
1043805817 8:84671052-84671074 TAAATACACCTGTTCCAAATGGG + Intronic
1044029215 8:87213911-87213933 TAAATACAGCTGTTCCAAATGGG + Intronic
1044279809 8:90341521-90341543 TAAATACAGCTGTTCCAAATGGG - Intergenic
1044447959 8:92300422-92300444 ATAATACAGCAGTCCAAAGGAGG - Intergenic
1044760626 8:95514034-95514056 TAAATACAGCTGTTCCAAATGGG + Intergenic
1045588086 8:103562338-103562360 TAAATACAGCTGTTCCAAATGGG + Intronic
1045919386 8:107511644-107511666 TAAATATACCTGTCCCAAATGGG - Intergenic
1045939984 8:107728030-107728052 TAAATACAGCTGTTCCAAATGGG + Intergenic
1046212485 8:111096074-111096096 ATAATGCAGGTTTCCCAAACTGG + Intergenic
1046255487 8:111691888-111691910 AGAACACAGCGGTACCAAATGGG - Intergenic
1046368735 8:113272046-113272068 AAAATACAGCCATTCCAAATGGG - Intronic
1046372273 8:113325010-113325032 TAAATACAGCTGTTCCAAATGGG - Intronic
1046400867 8:113702295-113702317 TAAATACAGCTATTCCAAATGGG + Intergenic
1046405781 8:113770214-113770236 TAAATACACCTGTTCCAAATGGG - Intergenic
1046589526 8:116189248-116189270 ATCATACAGCTGACCCAAAATGG + Intergenic
1047830247 8:128621747-128621769 ATAAAACAGCTCTACCAACTTGG + Intergenic
1048675058 8:136769465-136769487 TAAATACAGCAGTTCCAAATAGG + Intergenic
1048768352 8:137868249-137868271 TAAATACAGCTATCTCAAATGGG - Intergenic
1048772691 8:137912502-137912524 TAAATACAGCTATTCCAAATGGG + Intergenic
1048806627 8:138247024-138247046 TAAATACAGCTGTTCCAAGTGGG - Intronic
1048923431 8:139250753-139250775 AAAATACAGCTGTTCCAAATGGG - Intergenic
1049085675 8:140476953-140476975 AAAATACAGCTATTCCAAATGGG + Intergenic
1049825674 8:144666182-144666204 TAAATACAGCAGTTCCAAATGGG - Intergenic
1049903071 9:189025-189047 TAAATACAGCCATCCCAAATGGG + Intergenic
1049911683 9:275137-275159 ATAATAATGCTGTCCCTAGTAGG + Intronic
1050156079 9:2667463-2667485 TAAATACAGCCATCCCAAATGGG - Intergenic
1050695477 9:8275344-8275366 AAAATACAGCCCTTCCAAATGGG + Intergenic
1050832354 9:10029619-10029641 GAAATACAGCCGTTCCAAATGGG - Intronic
1050849388 9:10264542-10264564 TAAATACAGCTGTTCCAAATGGG - Intronic
1051902585 9:22059307-22059329 TAAATACAGCTGTTCCAAATGGG + Intergenic
1051957520 9:22713737-22713759 TAAATATAGCTGTTCCAAATGGG - Intergenic
1052187694 9:25619540-25619562 TAAATACACCTGTTCCAAATGGG + Intergenic
1052245430 9:26328493-26328515 ATAATACAGTTGGACAAAATTGG - Intergenic
1052351677 9:27465211-27465233 TAAATACAGCTGTTCCAAATGGG + Intronic
1052428700 9:28338287-28338309 TAAATACACCTGTTCCAAATGGG - Intronic
1052517818 9:29505618-29505640 ATAATTTAGCTATTCCAAATTGG + Intergenic
1052575971 9:30292695-30292717 CAAATACAGCTCTTCCAAATGGG + Intergenic
1052782474 9:32795532-32795554 TAAATACAGCTGTTCCAAATGGG + Intergenic
1053720910 9:40945951-40945973 TAAATACACCTGTTCCAAATGGG + Intergenic
1053746088 9:41199307-41199329 TAAATACAGCCATCCCAAATGGG + Intergenic
1053793518 9:41704037-41704059 TAAATACAGCCGTTCCAAATGGG - Intergenic
1053939970 9:43238270-43238292 ATTTTTCAGCTGTTCCAAATGGG + Intergenic
1054151659 9:61610793-61610815 TAAATACAGCCGTTCCAAATAGG + Intergenic
1054181928 9:61916052-61916074 TAAATACAGCCGTTCCAAATGGG - Intergenic
1054345083 9:63906205-63906227 TAAATACACCTGTTCCAAATGGG - Intergenic
1054481182 9:65665910-65665932 TAAATACAGCCATCCCAAATGGG - Intergenic
1054682257 9:68231973-68231995 TAAATACAGCCATCCCAAATGGG - Intergenic
1055175494 9:73313465-73313487 TAAGTACAGCTGTTCCAAATGGG + Intergenic
1055257131 9:74384813-74384835 ATAGCACAGTTTTCCCAAATGGG + Intergenic
1055483136 9:76729936-76729958 ATAATACAGCTATAAAAAATTGG - Intronic
1058181812 9:101808276-101808298 TAAACACAGCTGTTCCAAATGGG - Intergenic
1058619499 9:106867929-106867951 ATAATGCCGCAGTCACAAATAGG + Intronic
1058810100 9:108630903-108630925 GAAATACACCTGTTCCAAATTGG - Intergenic
1058834374 9:108848248-108848270 TAAATACAGCTGTTCCAAATGGG + Intergenic
1059482214 9:114600371-114600393 TAAACACAGCTGTTCCAAATGGG + Intergenic
1060178276 9:121513817-121513839 TAAATACAGCTGTTCCAAATGGG + Intergenic
1202782218 9_KI270718v1_random:10080-10102 TAAATACAGCCATCCCAAATGGG + Intergenic
1203635356 Un_KI270750v1:105698-105720 TAAATACAGCTGTTACAAATGGG + Intergenic
1186046423 X:5541614-5541636 CTAATACAGCTGTCACCATTTGG + Intergenic
1186165213 X:6820549-6820571 TAAATACAGCTGTTCCAAATGGG + Intergenic
1186323915 X:8458512-8458534 TAAATACAGCTGTTCCAAATGGG + Intergenic
1186538435 X:10373907-10373929 AAAATCCAGGTGTCCCATATGGG + Intergenic
1186700385 X:12083852-12083874 TACATACAGCTGTTCCAAATGGG - Intergenic
1186980696 X:14954782-14954804 TAAATACAGCAGTTCCAAATGGG + Intergenic
1188196483 X:27240919-27240941 TAGATACAGCTGTTCCAAATGGG - Intergenic
1188526157 X:31090055-31090077 GTAAAACAGGTGTGCCAAATCGG - Intergenic
1188764925 X:34079921-34079943 TACATACAGCTGTTCCAAATGGG + Intergenic
1189071214 X:37866158-37866180 TAAATACACCTGTTCCAAATGGG + Intronic
1189637110 X:43023117-43023139 TAAATACAGCTGTTCCAAATGGG + Intergenic
1190531729 X:51385736-51385758 TAAATACACCTGTTCCAAATGGG + Intergenic
1191211379 X:57888924-57888946 CAAATACATCTGTTCCAAATGGG + Intergenic
1191696669 X:63997129-63997151 TAAGTACAGCTGTTCCAAATGGG - Intergenic
1192003405 X:67181764-67181786 TAAATACAGCTGTTCCAAATGGG - Intergenic
1193422192 X:81294979-81295001 TAAATACAGATGTTCCAAATGGG - Intronic
1193485153 X:82078357-82078379 TAAATACAGCTGTTCCAAATGGG + Intergenic
1193887863 X:87006042-87006064 TAAATACACCTGTTCCAAATGGG + Intergenic
1193962931 X:87947770-87947792 TAAATACAGCTATTCCAAATGGG - Intergenic
1194032658 X:88835746-88835768 TAAATACACCTGTCCCTAATGGG + Intergenic
1194042822 X:88962806-88962828 AAATAACAGCTGTTCCAAATGGG - Intergenic
1194215715 X:91128466-91128488 TAAATACAGCTGTTCCAACTAGG + Intergenic
1194377224 X:93151402-93151424 TAAATGCAGCTGTTCCAAATGGG + Intergenic
1194723158 X:97364252-97364274 ATAATATAGCTTTGTCAAATTGG + Intronic
1194828880 X:98596559-98596581 TAAATACAGCTGTTCCAAATGGG + Intergenic
1195554775 X:106209952-106209974 TAAATACAGCCATCCCAAATGGG + Intergenic
1195823639 X:108973253-108973275 TAAATACAGCTGTTCCAAATGGG - Intergenic
1195863800 X:109408287-109408309 TAAATACAGCTGTTCTAAATGGG - Intronic
1195889148 X:109672413-109672435 ATAATACAGTTGTAACACATTGG + Intronic
1196294037 X:113978646-113978668 ATAATACAGCGGGACCAAACCGG + Intergenic
1196468821 X:116002106-116002128 ATAAAACATTTGTCACAAATGGG + Intergenic
1197052239 X:122074000-122074022 TAAATACAGCTGTTCCAAATGGG - Intergenic
1197301621 X:124788563-124788585 TAAATACAGCTATTCCAAATGGG + Intronic
1197426706 X:126305616-126305638 TAAATACACCTGTTCCAAATGGG - Intergenic
1197441363 X:126494869-126494891 TAAATACACCTGTTCCAAATGGG - Intergenic
1197798155 X:130319649-130319671 TAAATACAGCTATTCCAAATGGG - Intergenic
1198942055 X:141966573-141966595 TAAATACAGCTGTTCCAAATGGG - Intergenic
1198946971 X:142026528-142026550 TAAATACAACTGTCCCAAATAGG + Intergenic
1199020402 X:142871095-142871117 TAAATACAGCTGTTCCACATGGG - Intergenic
1199042311 X:143127859-143127881 TAAATACAACTGTTCCAAATGGG - Intergenic
1199284338 X:146039217-146039239 TAAATACAGCTGCTCCAAATGGG - Intergenic
1199301641 X:146220661-146220683 AAAATACACCTGTTCCAAATGGG + Intergenic
1199515172 X:148668049-148668071 TAAATACAGCTATTCCAAATGGG + Intronic
1200575716 Y:4885909-4885931 TAAATACAGCTATTCCAAATGGG - Intergenic
1201469551 Y:14318350-14318372 TAAATACAACTGTTCCAAATGGG - Intergenic