ID: 1120799874

View in Genome Browser
Species Human (GRCh38)
Location 14:88676000-88676022
Sequence CAAAATGCTGATGATGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120799874 Original CRISPR CAAAATGCTGATGATGACAC AGG (reversed) Intronic
902381720 1:16055891-16055913 CAGTCTGCTGATGAGGACACTGG - Intronic
902640985 1:17766012-17766034 CCAAAGGCTGAGGGTGACACTGG - Intronic
903320605 1:22540962-22540984 GAAAATGATGATGTGGACACGGG + Intergenic
903889717 1:26561344-26561366 CAAAAGGAGGATGCTGACACTGG - Intronic
903990818 1:27268124-27268146 CAAAATGATGATGAACACATTGG - Intronic
904924426 1:34036017-34036039 CCCAATGCTGGTGATGATACAGG + Intronic
906456609 1:46002722-46002744 CAAAATGCTGATGAACAGACAGG + Intronic
907727723 1:57035429-57035451 CAACACGCTCATGCTGACACTGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911820363 1:102411625-102411647 CAAAATGCTGAGTGTCACACTGG - Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912557629 1:110527730-110527752 CAGAATGCTCATGAAAACACAGG + Intergenic
915963233 1:160284348-160284370 CAGAATGGTGGTGAGGACACAGG - Intronic
916190234 1:162171070-162171092 CAACATGCTGGGGAAGACACAGG + Intronic
917011910 1:170484102-170484124 GAATATGCTGATGATAACAAAGG - Intergenic
917130582 1:171738368-171738390 CTCAATGATGATGATGTCACAGG - Exonic
917239530 1:172932804-172932826 CAAGGTGCTGATGTTGTCACAGG + Intergenic
918214528 1:182381862-182381884 GAAAATGCTAAGGATGAAACAGG + Exonic
918685088 1:187404630-187404652 CAAAATGTTGATGCTGGCTCAGG + Intergenic
920723570 1:208412741-208412763 AAAAATGATGATGATGATAGTGG - Intergenic
920975798 1:210783977-210783999 TAAAATGATGATGAAGACTCTGG + Intronic
921309716 1:213830893-213830915 CAAGATGCTGCTGTTGACAGTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922902947 1:229151635-229151657 AAAAATGCTAATGATCACCCGGG + Intergenic
923872442 1:238010634-238010656 CAACATGAAGATGATGACAAGGG + Intergenic
1064094568 10:12413551-12413573 GATAATGATGATGATGACATTGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066584342 10:36915445-36915467 TAAGATGATGATGATGACAGGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068539428 10:58274366-58274388 CAAAAAGCTGTGGATGCCACTGG - Intronic
1068721914 10:60254968-60254990 CAAAATGTGTAAGATGACACAGG + Intronic
1069044473 10:63727960-63727982 CAAAAATCTGATGATGATGCTGG - Intergenic
1069679355 10:70273080-70273102 TAAAATACTGATGATGTCACTGG + Intronic
1069927767 10:71862975-71862997 CACAATCTTGATGAAGACACTGG - Intergenic
1070368217 10:75756869-75756891 CACATTACTGATGATGACTCTGG + Intronic
1071036266 10:81249700-81249722 AAAGATGATGATGATGATACAGG + Intergenic
1071512079 10:86268336-86268358 CCAAATGCTGTTGGTGATACCGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1074418653 10:113289623-113289645 AAAAATACTGATGAGGTCACTGG + Intergenic
1074681090 10:115908501-115908523 AAGAATGCTTATGATGACATTGG + Intronic
1075033388 10:119042317-119042339 CGTAATGCTGATGATGACCGGGG - Exonic
1075194093 10:120339886-120339908 GAAAATGCTGATGTCGCCACAGG + Intergenic
1076677503 10:132154777-132154799 GATAATGGTGATGATGACAATGG + Intronic
1078825240 11:14923473-14923495 CAAGAGGCTGAAGAAGACACTGG + Intronic
1079544613 11:21617935-21617957 AAAAATACTGATGAGCACACAGG + Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080868952 11:36220189-36220211 CTAAGTGCTGGTGAGGACACAGG + Intronic
1082177372 11:49076695-49076717 CAAAATGCTAATGATGATGGTGG - Intergenic
1083187032 11:61023617-61023639 CAACATGGTGATGATGACGGTGG + Intergenic
1084143887 11:67253180-67253202 CAAAATGCTGAAGAGAACAAGGG - Intronic
1086594073 11:88550049-88550071 TAAAATGTTAAGGATGACACAGG + Intronic
1086688346 11:89759143-89759165 CAAAATGCTAATGATGATGGTGG + Intergenic
1086717514 11:90080802-90080824 CAAAATGCTAATGATGATGGTGG - Intergenic
1087362830 11:97182281-97182303 CAAAATTCTGATGCTGAATCTGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088017327 11:105076881-105076903 GAAAAGGCTGTTGATCACACTGG - Intronic
1088099258 11:106136595-106136617 CAGAATGCTCTTGATCACACTGG + Intergenic
1088901464 11:114120870-114120892 CAAAAGGCTGAAGAGGAGACAGG - Intronic
1090314776 11:125776581-125776603 CAAAATGCTGATAATGTGGCAGG - Exonic
1090524577 11:127518711-127518733 CATGATGCTGATGATGAGAAAGG - Intergenic
1091186795 11:133654715-133654737 AAAAAGGCTGATGGCGACACGGG - Intergenic
1093929954 12:24945947-24945969 CATAAGGCTGATCATGCCACTGG + Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095620274 12:44245730-44245752 CAAAATGCTGCTGAGAACTCTGG + Intronic
1097938276 12:65277958-65277980 CAAAATGCTTAAGTTTACACCGG - Intergenic
1098859671 12:75693893-75693915 TATAATGCTGATGGTGACAGTGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100872527 12:98925270-98925292 GGAAATGCTGATGATGAGACTGG + Intronic
1101277143 12:103215351-103215373 TAAAAATCTGATAATGACACTGG + Intergenic
1103413693 12:120730297-120730319 GAAAATGCTGATGGTGAGAAAGG + Intronic
1104025226 12:125021128-125021150 CAAAATGCTCACGATGCCTCAGG + Intronic
1104042401 12:125139126-125139148 CTAAATGCTGAAAATGGCACTGG - Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1109800854 13:67376637-67376659 CAAAATAGTTATGATGACATTGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1111459346 13:88519394-88519416 CAAGTTGCTGATAATGACACGGG + Intergenic
1112190814 13:97175530-97175552 CAAATTGCTGAAGATGTCACTGG + Intergenic
1113233538 13:108242135-108242157 CAAAATGCTGCTGATGATCGAGG - Intergenic
1113791993 13:113033856-113033878 CAAAATGCTGATGTGGAGACGGG - Intronic
1113930504 13:113966128-113966150 TATAATGGTGATGATGACAATGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1115534962 14:34364193-34364215 GAGAACCCTGATGATGACACTGG - Intronic
1115668111 14:35576504-35576526 CAAAATGTAAATGAAGACACTGG - Intronic
1118151204 14:63192763-63192785 CAAAATCCTGTTGAGGACATAGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120696919 14:87655053-87655075 CAGAATCCTCATGATGTCACTGG + Intergenic
1120799874 14:88676000-88676022 CAAAATGCTGATGATGACACAGG - Intronic
1122250097 14:100432104-100432126 CAACTTGCTGATGCTGAAACTGG - Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123216477 14:106813334-106813356 CAAACTGCGGCTGAAGACACGGG + Intergenic
1123754853 15:23389214-23389236 CAAAATGGTAATGATGACCTAGG - Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126713747 15:51490629-51490651 TAAAATGGAGATGATGACATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1131404500 15:92153555-92153577 AAAAAAGTTGATGATGTCACAGG - Intronic
1131883372 15:96882496-96882518 TAAAAAGCTGATGATGAAACTGG - Intergenic
1133547407 16:6820885-6820907 CAAACTGCTAAGGATGACAAAGG - Intronic
1133571347 16:7043289-7043311 TAAAATAATGATGATGATACAGG - Intronic
1133653026 16:7830918-7830940 CTAAATGCTGGTGAAGAGACTGG - Intergenic
1133853102 16:9524452-9524474 GCAAATGATGATGATGACAATGG - Intergenic
1134461521 16:14433766-14433788 CAAAATGGTAATGATGACCTAGG + Intergenic
1135226882 16:20668448-20668470 GAAAATAATGATGGTGACACAGG + Intronic
1135915819 16:26604566-26604588 CACACTGCTGATAAAGACACAGG - Intergenic
1137093909 16:36229043-36229065 CAATACGATGATGATTACACTGG + Intergenic
1137368356 16:47880869-47880891 AACAATGATGATGATGACAATGG - Intergenic
1137767367 16:50988257-50988279 CAAAATGGTGATCAAGATACAGG - Intergenic
1138052837 16:53799431-53799453 CAAAATGGTGATCAAGACATAGG - Intronic
1138849640 16:60611649-60611671 CAAAATGGGAAGGATGACACTGG + Intergenic
1138923595 16:61563857-61563879 TAAAATGCTGAATATGACAAAGG - Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139332869 16:66207393-66207415 CAAAAAACTGATTATGACAGAGG - Intergenic
1140297101 16:73719358-73719380 CAAAATGCTGGTGACCACGCAGG - Intergenic
1140462822 16:75154730-75154752 CAAAATGCTGGTGAGGATGCAGG - Intronic
1147446498 17:40478198-40478220 CAAAGTGTTGATGAGGGCACAGG - Intronic
1147526745 17:41232204-41232226 AATGATGCTGATGATGAGACGGG + Intronic
1147527254 17:41237763-41237785 AATGATGCTGATGATGAGACGGG + Intronic
1147530793 17:41275401-41275423 AACAATGCTGATGATGAGACGGG + Intergenic
1149689148 17:58559209-58559231 CAAGATAATGATGATGAGACTGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156982830 18:43311315-43311337 AAGAATGCTTATGATTACACAGG - Intergenic
1157995002 18:52544510-52544532 ATCAATGCTGATGATCACACAGG + Intronic
1161418071 19:4159091-4159113 CACAAGGCTGAGGAAGACACAGG - Intronic
1162151692 19:8650303-8650325 CAATGTGCTGATCTTGACACTGG - Intergenic
1164720456 19:30428227-30428249 CAACATGCAGATGGTGACAGGGG + Intronic
1165717479 19:38055777-38055799 CAACATGCAGATGAAGAAACAGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925620535 2:5787750-5787772 CAGAATGTTGAAAATGACACTGG - Intergenic
927575639 2:24200051-24200073 CCAGGTGCTGAAGATGACACAGG - Intronic
928095649 2:28403438-28403460 CAAGATGCTGATGATGGGAAGGG + Intronic
928824185 2:35399091-35399113 TAAAAAGCAGTTGATGACACTGG - Intergenic
928975892 2:37086108-37086130 CAAAATCCTGTTGGTTACACAGG + Intronic
929426655 2:41850997-41851019 CAAAATGCTGATAACTGCACTGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
934912202 2:98269463-98269485 CAGAATGCTGATGAGAACAGTGG - Intronic
935270814 2:101432870-101432892 CACAAGGCAGATCATGACACAGG + Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937268779 2:120633784-120633806 CAAAATGGTGATGAGGAGAGGGG + Intergenic
937535112 2:122876711-122876733 TAAAATGATGATGCTGGCACAGG - Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940094294 2:149956617-149956639 CAAATTGCTGATGATGACTGAGG + Intergenic
940261872 2:151789479-151789501 CAAACTGCTGATGTTTACATTGG - Intronic
940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940532074 2:154890465-154890487 GAAAATGCAGATATTGACACAGG + Intergenic
940721210 2:157284320-157284342 CACAAAGCACATGATGACACTGG - Exonic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942257168 2:174114655-174114677 GAAAATGCTGATTATCACCCAGG + Intronic
942642031 2:178071120-178071142 CAAAATGCTCATCTTAACACCGG + Intronic
944469705 2:200039902-200039924 CAAAATCCTGAGGTTGTCACGGG + Intergenic
944641552 2:201731445-201731467 TAAAAGGCTGATGATGAAATCGG + Intronic
945234220 2:207619687-207619709 CAAAATGCTAATGGTAACTCTGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946150424 2:217762501-217762523 AAAAATGCAGATGAAGAAACAGG - Intergenic
946425595 2:219594077-219594099 CAAAGTGCTGATGATAAAAGAGG - Intergenic
947161071 2:227215140-227215162 AAAAATGATGATGATGAGACTGG - Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948686348 2:239672183-239672205 AAAAATGTTGATCATGACAGTGG - Intergenic
1169619030 20:7483848-7483870 CAAAATACTGTTGTTCACACTGG + Intergenic
1169693619 20:8361551-8361573 CCAAATGATGATGATGCCATAGG + Intronic
1170303262 20:14909452-14909474 TAAAAACCTGATGCTGACACTGG + Intronic
1170540570 20:17383279-17383301 CAAAATGCTGGTGTTGACTGAGG - Intronic
1170720616 20:18874780-18874802 AAAAATTCTGAAGATAACACTGG - Intergenic
1172023573 20:31933183-31933205 CAAAGTGCTGCTGATGTCACTGG + Intronic
1174686010 20:52456222-52456244 CCAGGTGCTGCTGATGACACAGG - Intergenic
1174863736 20:54115690-54115712 CCAAATCCTGAGGATGAGACTGG + Intergenic
1174881677 20:54285883-54285905 CAAAATGCTAAAGATGGCAGAGG + Intergenic
1175468774 20:59210764-59210786 TGAAATGCTGATGTTGAAACAGG - Intronic
1175969685 20:62678324-62678346 CCAAGTGCTGATGAGGACTCTGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177753277 21:25313465-25313487 AATAATGCTGATGTTCACACAGG - Intergenic
1178206466 21:30472953-30472975 CAAAACTTTGAGGATGACACTGG + Intergenic
1179075076 21:38113415-38113437 CAAAATGCTGCTGGTGTGACTGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179315192 21:40237857-40237879 GAAGATCCTGGTGATGACACTGG + Intronic
1181247112 22:21511257-21511279 CAAAATGATGAGGACCACACCGG + Intergenic
1181508860 22:23379907-23379929 CACAGGGCTGATGAGGACACTGG - Intergenic
1182655136 22:31884099-31884121 CAAGATGCTGATGATGAGGGTGG - Intronic
1184175147 22:42784820-42784842 CAGAATCATGATGCTGACACTGG + Intergenic
1184987805 22:48147239-48147261 CAGAATGATGATGATGGCTCCGG - Intergenic
950910867 3:16590137-16590159 CAAAGTTCTGATGATTACATAGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951218053 3:20042097-20042119 TAAAATGCTGATTATGAATCAGG + Intronic
952261236 3:31742511-31742533 CAGAATGCAGTAGATGACACAGG - Intronic
952803767 3:37324889-37324911 CAAAATGCTGGAAATGGCACAGG + Exonic
953333568 3:42074639-42074661 CAAAATGCTTATGATCCCAAGGG + Intronic
953953448 3:47211572-47211594 CAAAATGCTGCCAAAGACACGGG + Intergenic
954887806 3:53891893-53891915 CAAAATGCTGACGAGGACGAAGG + Exonic
955554142 3:60118001-60118023 CAAAATGCTGATGATCCAAGCGG + Intronic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
955815479 3:62837966-62837988 CAAAATGCACATGCTGACAGAGG + Intronic
956118165 3:65939434-65939456 CTAAATGTAGATGATGACAGTGG + Intronic
956176355 3:66476823-66476845 CAAAATCCTCATGAGGACTCTGG + Intronic
957567388 3:81902714-81902736 AATAATGATGATGATGACACAGG + Intergenic
957884167 3:86262327-86262349 CAAAATGCTATTGAAGCCACTGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960024685 3:112994993-112995015 AACTATGCTGATGATGACACAGG - Intronic
960322722 3:116256372-116256394 CAAAATACTGAAGAAAACACTGG + Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963251774 3:143110462-143110484 TAAAATGCAGATTCTGACACAGG + Intergenic
963327230 3:143876228-143876250 GAAAATGCTGATGCTGTCACTGG + Intergenic
963465506 3:145675825-145675847 CAAAATGGGGATGATAACAAAGG + Intergenic
963723781 3:148895551-148895573 AAAAATGCAGAAGATGCCACTGG - Intronic
964172442 3:153786830-153786852 CAAAAGGATAATGATGACATAGG - Intergenic
964339457 3:155693068-155693090 AAAAATGCTGATGATTAGGCCGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965806016 3:172542655-172542677 CAAAATGCAGATGCTGACCCAGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967454005 3:189660244-189660266 CAATATGCAGAAGATGAAACTGG - Intronic
968257108 3:197285735-197285757 CCAAATGCTGGTGAGGACACAGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970897632 4:21121873-21121895 CAAAATTCTGAAGCTGACAGAGG - Intronic
971292553 4:25358228-25358250 AAAAATGGAGATGAAGACACAGG - Intronic
971443342 4:26714561-26714583 CAAAATGCTGAATTTGCCACTGG - Intronic
971556352 4:28016956-28016978 AAAAATGATGATGATGAAAAAGG + Intergenic
973539345 4:51920632-51920654 CTAAATGCTGATGAGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973821227 4:54663333-54663355 TAAAATGGAGATGATGACATAGG + Intronic
974625859 4:64428543-64428565 CAAAATGCTAATCATAATACAGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975382017 4:73711546-73711568 CAAAATGATGCTGATGGCTCAGG + Intergenic
976287660 4:83385769-83385791 AGAAATGCTGATGATGACTATGG - Intergenic
976368245 4:84255482-84255504 AAAAATGGTGTTGATGAAACAGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
982724348 4:158889709-158889731 CAACATGCTGGTCATGCCACGGG - Intronic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984079177 4:175221979-175222001 CAAAATACTGAAGATTATACAGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984476646 4:180243864-180243886 AAAAATTCAGCTGATGACACTGG + Intergenic
984678272 4:182576141-182576163 CAAACTGCTCATGATGTGACAGG - Intronic
984773274 4:183456989-183457011 GAAGATGCTGCTGACGACACAGG + Intergenic
985019612 4:185673841-185673863 ACAAATGCTGTTGATGAGACAGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
987507177 5:18788370-18788392 CCAAATGCAGATGAGGACAGTGG + Intergenic
987509063 5:18812140-18812162 CAAAATGCTGATGCTAACCATGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989405547 5:41057047-41057069 CCAAGTGATGATGATGACAATGG - Intronic
989535081 5:42553744-42553766 CAAAGTGTTGCTGATGAGACTGG - Intronic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992495543 5:77289735-77289757 CAAAATGCTGTTCCAGACACTGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993070309 5:83153619-83153641 AAAAATAGTGATGATGACAAAGG + Intronic
993271234 5:85799211-85799233 CAAAATGTTGAGGTTGATACTGG + Intergenic
994037669 5:95221330-95221352 GAAAATGCTTAGGATGAAACAGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
997202558 5:132020624-132020646 CAAAATGCACATGCTGACTCTGG - Intergenic
999533326 5:152487195-152487217 CAAAATGATGATGATACCATTGG + Intergenic
1000310012 5:160033446-160033468 CAATATGCTATTGATGAGACCGG - Intronic
1000486681 5:161854199-161854221 CAAAATCCTGGTGAAGACAGTGG - Exonic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000804919 5:165777998-165778020 CACACTGCTGATGAGGACTCAGG + Intergenic
1001209036 5:169793197-169793219 CAAAATGCATATGCTTACACAGG + Intronic
1001585454 5:172831183-172831205 CAATATCCTGTTGATTACACAGG + Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004451405 6:15751148-15751170 CAAAATGTTGAAAATGACAAAGG - Intergenic
1004823426 6:19394672-19394694 TAAAATCCTTATGAGGACACAGG - Intergenic
1005801074 6:29425681-29425703 CAAAATGTTGATGTTGAAGCTGG + Exonic
1007817958 6:44538129-44538151 GACAATGCTGATGGTGACAAGGG + Intergenic
1008701029 6:54099997-54100019 TTAAATGATGATGATGTCACTGG + Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011136014 6:84101885-84101907 GATAATGATGATAATGACACAGG - Intergenic
1011674069 6:89714219-89714241 CAAGAGGCTGTTGATGACCCTGG + Intronic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1011894921 6:92213865-92213887 AATAATGATGATGATGACAATGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014698904 6:124658596-124658618 TAAAATGCTGATGATAACAAAGG - Intronic
1015448060 6:133331410-133331432 AATAATGCTGATGATGACACAGG - Intronic
1016418637 6:143860435-143860457 CAATATGATGATGATGAAATTGG + Exonic
1016475117 6:144418936-144418958 GAAAATACTGATGATGGCAAGGG - Intronic
1016533819 6:145089277-145089299 CAGAAAGCTGATCATCACACAGG - Intergenic
1016547058 6:145236069-145236091 CAAAATGCAGATGCTGGCAAAGG - Intergenic
1016851365 6:148622545-148622567 TAAAATGCTGATCATGACCTGGG + Intergenic
1017929578 6:158940020-158940042 CCAAATGCTAATGGTGACAAAGG + Intergenic
1017942023 6:159061420-159061442 CTAAGTGCTGATGAGGACAACGG - Intergenic
1018501402 6:164414380-164414402 GGAAATGCCGATGATGACAGTGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019114025 6:169742248-169742270 TAAAATGGTGATGATAAAACTGG - Intronic
1019980413 7:4617510-4617532 CAAAATGCTGGTGAGGATGCAGG + Intergenic
1020992608 7:15219721-15219743 CAGTAAGCTGATGATGACAGTGG + Intronic
1023529426 7:41137098-41137120 CAAAGTGCTGGTGATGGCAGTGG - Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024663490 7:51521790-51521812 CAAAATGGTAATCATAACACAGG - Intergenic
1025605293 7:63035818-63035840 CAAAATGGTGTTCATGACAACGG - Intergenic
1026464558 7:70643048-70643070 CAAAATGAAGATGAGGAGACGGG - Intronic
1027378453 7:77577925-77577947 CAAAATGTTGATAATGAAGCTGG + Intronic
1027521748 7:79217292-79217314 AAATATGCTGATGGTGACAAAGG + Intronic
1028120503 7:87051923-87051945 CAAGATGCTGGTGATAAAACAGG - Intronic
1029102384 7:98142782-98142804 TAAAATGCTGATGATGTTCCAGG - Intronic
1029886708 7:103880505-103880527 GATAATGATGATGATGACAAAGG - Intronic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1033990643 7:147281887-147281909 CTACCTGCTGATGATCACACAGG - Intronic
1034072619 7:148201390-148201412 AAAAATGGTGATGAGGTCACAGG - Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034921004 7:155082023-155082045 CACAGTGGTGATGATCACACTGG - Intronic
1036740882 8:11360751-11360773 CAAAAGGCTGATGCTGAACCAGG - Intergenic
1036779635 8:11636931-11636953 CAAAATGGTGTTCATGACAAGGG + Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037900683 8:22686736-22686758 CAAAATGCAGATGCAGACACAGG + Intergenic
1037980951 8:23253756-23253778 CAAAATTCAGAAGATAACACTGG - Intronic
1038570421 8:28657460-28657482 CATAATGCTGAAGATGTCATTGG - Intronic
1040433010 8:47362434-47362456 GGAAATGCTGGAGATGACACTGG - Intronic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040659072 8:49548335-49548357 TAAAATTCTGATCATGCCACAGG - Intronic
1041337311 8:56800828-56800850 CAAAATGCTTATAATACCACAGG - Intergenic
1041635151 8:60134422-60134444 CAAAGGGCTGAGGGTGACACAGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044091374 8:88006584-88006606 CAAAATGCTGCTGTTTTCACAGG + Intergenic
1045005382 8:97912817-97912839 CAAGATGCTGAGGATGACAGAGG + Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046130524 8:109962348-109962370 CAAAATGCTGTTGATGAATCTGG + Intergenic
1046807414 8:118494938-118494960 AAACTTGCTTATGATGACACAGG - Intronic
1047408309 8:124603541-124603563 TAAAATGCTGATGAAGCCAGAGG - Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1049650137 8:143762511-143762533 CAGTATGCTGATGAGGGCACAGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1053026006 9:34728901-34728923 CTGGATGCTGAGGATGACACAGG + Intronic
1053186545 9:36021373-36021395 CAACAAGCTTATGATGACCCAGG + Intergenic
1053947049 9:43321356-43321378 CAATACGATGATGATTACACTGG + Intergenic
1054941751 9:70750577-70750599 CAGAATGAGGATGATGGCACTGG + Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1057505926 9:95633441-95633463 CAAAATGATATTGATGACAATGG - Intergenic
1058756621 9:108088663-108088685 CAAGATGCTGATGCTGAAAATGG - Intergenic
1059500950 9:114753709-114753731 CCACATGCTGAAGATGACAGAGG - Intergenic
1059568126 9:115404319-115404341 CTAAATGCTTATGATGAATCAGG + Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1060179978 9:121527334-121527356 CAAAGTGCTGGTGATGGCAGTGG + Intergenic
1061960734 9:133987709-133987731 CAAACTGCTGATGCTGGCACAGG + Intronic
1203590179 Un_KI270747v1:49914-49936 CAATACGATGATGATTACACTGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186633983 X:11382036-11382058 GACAATGGTGATGATGACAGTGG + Intronic
1187426369 X:19181022-19181044 CAAAATTCTGATGATGGGACTGG - Intergenic
1187627175 X:21128654-21128676 TAAAATGCAGATTATGACTCAGG + Intergenic
1187742276 X:22368854-22368876 CAATTTGCTGATGATGACTTCGG + Intergenic
1187929782 X:24283498-24283520 CAAAATGCTCATGGGGACAGTGG + Intergenic
1188051131 X:25487960-25487982 CAAGATGATGATGATGATAACGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188740750 X:33777431-33777453 CAAAATACTGAATGTGACACAGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192207195 X:69104352-69104374 TAAAATGGTGATGATGATAATGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193527806 X:82614991-82615013 CAAAATGATAATGTTAACACAGG + Intergenic
1193815033 X:86095049-86095071 CAAAGGGAAGATGATGACACAGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194640973 X:96404004-96404026 CATGATGGTGATGATGACTCTGG - Intergenic
1194943658 X:100042722-100042744 CAAAATGATGAGGATGTCAAAGG - Intergenic
1196426188 X:115571766-115571788 TAAAATGCTGAGGATGGCAGAGG + Intronic
1199142381 X:144328643-144328665 CATAATTCTGATAATCACACTGG - Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199518579 X:148707831-148707853 CAAAATTCTAATGATGACATTGG - Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201232752 Y:11880491-11880513 CAAAATGCTAAAGAAAACACCGG - Intergenic
1201643935 Y:16206462-16206484 CAAAATGCTGGTGGTGTTACTGG - Intergenic
1201658880 Y:16378859-16378881 CAAAATGCTGGTGGTGTTACTGG + Intergenic