ID: 1120800156

View in Genome Browser
Species Human (GRCh38)
Location 14:88678980-88679002
Sequence CCTTGTTTCTCTCTAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 1, 2: 12, 3: 71, 4: 430}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120800153_1120800156 7 Left 1120800153 14:88678950-88678972 CCGTTGTGAAAGTTCTTGGGAAT 0: 1
1: 0
2: 1
3: 16
4: 242
Right 1120800156 14:88678980-88679002 CCTTGTTTCTCTCTAGCTTCTGG 0: 1
1: 1
2: 12
3: 71
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120800156 Original CRISPR CCTTGTTTCTCTCTAGCTTC TGG Intronic
900282015 1:1876059-1876081 CCTTTCTTCTTTCTGGCTTCTGG - Intronic
900546027 1:3229676-3229698 CCTGGTTTGTCTCCAGCTGCAGG - Intronic
901691940 1:10979423-10979445 CATTCTTTCTTTCCAGCTTCTGG - Intronic
903206161 1:21783856-21783878 TCTAGTTCCTCTCTAGCTCCTGG + Intergenic
903464186 1:23540620-23540642 CCTTGTCTCTCTCTAGTTCAAGG + Intergenic
903493298 1:23745701-23745723 CCTTGTTCCTCTCAACCTTCTGG + Intronic
904357167 1:29947817-29947839 CCTTGTTTCTCTCCCTCTTGCGG + Intergenic
904727580 1:32561437-32561459 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
904892079 1:33787154-33787176 CCCTGCTTCTCCCTAGCTTCTGG - Intronic
904911836 1:33940104-33940126 CCTTTTCTCTTCCTAGCTTCTGG + Intronic
904967828 1:34392466-34392488 GCTTCTTTCTCTCTACCTTTAGG + Intergenic
905253096 1:36662367-36662389 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
907492421 1:54816603-54816625 CCTTGCCTCTTTGTAGCTTCTGG + Intronic
908382920 1:63613441-63613463 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
908769962 1:67586985-67587007 CCATTTCTCTCTCTAACTTCAGG + Intergenic
908877170 1:68690800-68690822 CCTTTTATCTCTATATCTTCAGG - Intergenic
908893188 1:68868947-68868969 TCTTGTCTCTCTCTCTCTTCAGG - Intergenic
909248395 1:73320405-73320427 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
909442390 1:75712128-75712150 ACTTGTTTCTCTCTGTTTTCTGG + Intergenic
909805876 1:79873715-79873737 TCTTGTCTGTCTCTTGCTTCTGG + Intergenic
910552354 1:88490012-88490034 CTTTTTTTCTTCCTAGCTTCTGG - Intergenic
911028984 1:93466072-93466094 ATTTGTTTCTTTGTAGCTTCTGG + Intronic
911494954 1:98620115-98620137 ATTTGTTTCTCTGTAGATTCTGG + Intergenic
912259509 1:108096421-108096443 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
912510828 1:110189163-110189185 GCTTGTCTCTCTCTGGCTCCAGG + Intronic
912870339 1:113298611-113298633 CCTTGTTTCTCTCTGAATGCAGG - Intergenic
912926035 1:113913698-113913720 TTTTGGTTCTCTTTAGCTTCTGG + Exonic
913176240 1:116275681-116275703 CCTTGCCTCTCACTAGCTTCTGG + Intergenic
913441959 1:118907696-118907718 TCTTGCTCCTCTTTAGCTTCAGG + Intronic
914225512 1:145716690-145716712 CCTGGGTTCTCTCTCACTTCTGG + Intergenic
914229952 1:145756687-145756709 CCATGATTCTCTCTGGCTTCTGG + Intronic
914388875 1:147200003-147200025 TCTTGTTTCTCTCTATCCTGAGG + Intronic
914811858 1:151034671-151034693 TCTCTTTTCTCTCTAGCTTGAGG - Exonic
915967917 1:160328081-160328103 CTTTATTTCTCTCTACCTACTGG - Intronic
916767244 1:167873232-167873254 TATTCCTTCTCTCTAGCTTCAGG + Intronic
916963653 1:169913426-169913448 CCTTGTTTCTTCCTGGCTTCTGG - Intergenic
916963663 1:169913478-169913500 CCTTGTTTCTTCCTGGCTTCTGG - Intergenic
916963673 1:169913530-169913552 CCTTGCTTCTTCCTGGCTTCTGG - Intergenic
917592695 1:176493441-176493463 CCATGTTCCTCAATAGCTTCAGG - Intronic
918118410 1:181516661-181516683 CCTTGTGTCTCTTTGGGTTCAGG + Intronic
918290418 1:183102112-183102134 CTTTGTCTCTCTCTGGCTGCCGG - Intronic
920659095 1:207899997-207900019 CCTCGTTTCCCTATAGCTTCTGG - Exonic
920833627 1:209487644-209487666 CCTTGTCTCTTCCTGGCTTCTGG - Intergenic
920839607 1:209543257-209543279 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
922055916 1:222042458-222042480 CCGTGTCTCTCTCTAGTTCCTGG + Intergenic
922918100 1:229275334-229275356 CCTTGCCTCTCTCTAGCTTCTGG - Intronic
924677214 1:246191318-246191340 CATTTTTTCACTCTAGCTTGCGG - Intronic
924744846 1:246822367-246822389 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
1063003657 10:1947737-1947759 CCTTGCCTCTCCCAAGCTTCTGG + Intergenic
1064320035 10:14296413-14296435 CCTTGCCTCTCTCAAGCCTCTGG + Intronic
1064703663 10:18048129-18048151 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1065726702 10:28674501-28674523 ACTTGTTTCTCTTTAATTTCTGG + Intergenic
1067111184 10:43401744-43401766 CCTCCTTTCTCTCCAGCTCCAGG - Intronic
1067864938 10:49894908-49894930 CCTGGTCTCTTCCTAGCTTCTGG + Intronic
1067974477 10:51008477-51008499 CCTTGCCTCTTTCTAGCTTCTGG + Intronic
1068566593 10:58582717-58582739 CCTTGTCTTTCTCCAGCTTTTGG + Intronic
1069296358 10:66849682-66849704 CCTTGACCCTCCCTAGCTTCTGG - Intronic
1070236444 10:74632481-74632503 CCTTGTCTCTTCCTAGCTACTGG + Intronic
1070648985 10:78221547-78221569 CCAAGTTTGTCTCTAGCTTATGG - Intergenic
1071878192 10:89865519-89865541 CCCTGCTTCTCACTATCTTCTGG - Intergenic
1072294452 10:93995444-93995466 CCTTTCTGCTCTCTACCTTCTGG + Intronic
1072594695 10:96860447-96860469 CCTTGTTTCTTCCTAGCTTCCGG - Intronic
1072995549 10:100240529-100240551 CCTTTTTCCCCTCTAGTTTCAGG + Intronic
1073620078 10:105037478-105037500 CCTTGCCTTTTTCTAGCTTCTGG + Intronic
1073831646 10:107390893-107390915 CTTTGTATTTCTCTAGCTTGGGG - Intergenic
1074726875 10:116319907-116319929 CCTTGCCTCTCCCCAGCTTCTGG - Intergenic
1074765765 10:116698977-116698999 CCTTCTCTCCCTCTAGCTCCTGG + Intronic
1077640211 11:3874522-3874544 CCAGGTCTCTCCCTAGCTTCAGG + Intronic
1078522687 11:12075967-12075989 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1078862059 11:15257768-15257790 CCAGGCCTCTCTCTAGCTTCTGG - Intergenic
1079328422 11:19513902-19513924 CCTTGCATCTTCCTAGCTTCTGG - Intronic
1080046334 11:27812396-27812418 CCATGTTTCTCACTAGGTCCAGG - Intergenic
1080113802 11:28599390-28599412 CTTTGTGTCTTCCTAGCTTCTGG - Intergenic
1080865470 11:36190551-36190573 CCTTGTGTTTTTCTACCTTCTGG - Intronic
1081196967 11:40173072-40173094 CCTTGTTTTCTTCTAGCTTCTGG - Intronic
1081340615 11:41922615-41922637 CTCTATTTCTCACTAGCTTCAGG - Intergenic
1081562504 11:44230675-44230697 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1082194035 11:49280355-49280377 CCCTCTTTCTCTCTCTCTTCTGG - Intergenic
1083396388 11:62395535-62395557 ACTTCTTCCTCTCTAGCTTGAGG + Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1085404461 11:76253770-76253792 CCTTGTATCTTTCTAGCTTCTGG + Intergenic
1085865969 11:80292696-80292718 CTTTGTTTTTCTCTAACTGCAGG + Intergenic
1085880024 11:80455567-80455589 CCTTGTCTCTTTCTAGTTTCTGG + Intergenic
1086155656 11:83662924-83662946 CACTGTTGGTCTCTAGCTTCAGG + Intronic
1086172539 11:83852051-83852073 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1086672116 11:89560686-89560708 CCTTCTTTCTCTCTCTCTTCTGG + Intergenic
1086756462 11:90569665-90569687 CCTTGCTTTTTTCCAGCTTCTGG - Intergenic
1086903986 11:92398083-92398105 CCTTGTCTCTTGCTAGCTTCTGG + Intronic
1086916491 11:92535290-92535312 CCCTGTTTTTTCCTAGCTTCTGG - Intronic
1087100298 11:94357271-94357293 CCTGGGGTCTCTCTAGCTTTTGG + Intergenic
1087614745 11:100474953-100474975 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1088019317 11:105100398-105100420 ACTTCCTTCTCTCTGGCTTCAGG - Intronic
1088424311 11:109685448-109685470 TCTTGCTTCTCCCTAGCTTCTGG - Intergenic
1088594707 11:111432134-111432156 TCTCCTTTCTCTCTAGCTCCAGG - Intronic
1088605981 11:111532564-111532586 CTTTGCTTCTTTCTAGTTTCTGG - Intronic
1090146907 11:124334479-124334501 CGGTTTTTCTCTCTAGCGTCAGG - Intergenic
1090580553 11:128154090-128154112 GGTCCTTTCTCTCTAGCTTCAGG - Intergenic
1091150194 11:133321211-133321233 CCTAGTTACTCTCCAGCTTCTGG + Intronic
1091769862 12:3144504-3144526 CCTGGCCTCTTTCTAGCTTCTGG - Intronic
1093626662 12:21357384-21357406 CCATGCCTCTTTCTAGCTTCTGG - Intronic
1094033084 12:26036174-26036196 CCATGTTCCTCGCTAACTTCTGG + Intronic
1094298953 12:28939362-28939384 CCTCGTTTCTCTCTACCCACTGG + Intergenic
1094507237 12:31072393-31072415 TCGTGTATCTCACTAGCTTCAGG - Intergenic
1095345681 12:41146642-41146664 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1095573047 12:43704344-43704366 TCTTGTTTCTTCCAAGCTTCAGG - Intergenic
1096117444 12:49063356-49063378 CCTTATTTCTTTTTAGATTCTGG + Intergenic
1096704783 12:53412859-53412881 CATTGTCTCTCTCGACCTTCTGG + Intronic
1096717028 12:53497810-53497832 CCTTCTTTCTCTCCAGATCCAGG + Intronic
1098608492 12:72424183-72424205 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1099029282 12:77505229-77505251 CTTTCTATGTCTCTAGCTTCAGG + Intergenic
1099384888 12:82002405-82002427 CCTTGTTTCTCACAAGCATCAGG - Intergenic
1099765781 12:86981595-86981617 CCTTCTTGCTCTCTAAGTTCAGG - Intergenic
1100418900 12:94409758-94409780 CCTTGCCTCTTTCTAGCTTCTGG + Intronic
1101241749 12:102846005-102846027 CCTTGTATCTCTGTAGCCTCTGG + Intronic
1101344592 12:103874757-103874779 CCTTGCCTCTCTCCAGCTTCTGG + Intergenic
1101364707 12:104061046-104061068 CCATGCCTCTTTCTAGCTTCTGG - Intronic
1101742329 12:107510300-107510322 CCTTGTTTGTCTCTGGCTGCAGG - Intronic
1102009688 12:109610646-109610668 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1103313518 12:120032273-120032295 CCTTGTTTCTGTCATTCTTCAGG - Intronic
1103448181 12:121008566-121008588 CTTTGTGACTCTCTGGCTTCAGG - Intronic
1103456691 12:121072882-121072904 CTTTGCTTCTTTCTAGCTTCAGG + Intergenic
1105284305 13:18992317-18992339 CCTTCTGTCCCTCTACCTTCTGG - Intergenic
1106352838 13:28950613-28950635 CCATATTTCTCTCTCGCTTTGGG - Intronic
1106706048 13:32280788-32280810 GTTTGTTTCTTTATAGCTTCCGG + Intronic
1107340163 13:39396912-39396934 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1107711330 13:43153187-43153209 CCTTGACTCTTCCTAGCTTCTGG + Intergenic
1108364691 13:49698154-49698176 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1108562511 13:51659666-51659688 CCTTGTCTCTCTACAGCTGCTGG + Intronic
1108564281 13:51679788-51679810 CCTTGCTTTTTCCTAGCTTCTGG + Intronic
1108611335 13:52086917-52086939 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1109120287 13:58447875-58447897 ACTTGTTTCCTTGTAGCTTCTGG + Intergenic
1110347955 13:74470383-74470405 CCTTGCTTCTTTCTAGCTTCTGG + Intergenic
1110808571 13:79787697-79787719 CCTTGTTTTCTTCTAGTTTCTGG + Intergenic
1111638245 13:90932826-90932848 CCATGTTTCCCCTTAGCTTCAGG + Intergenic
1111727651 13:92032790-92032812 GTCTGTTTCTCTCAAGCTTCAGG + Intronic
1111967807 13:94878530-94878552 CCTTGCTTCTTTCTAGCTTCTGG - Intergenic
1112094765 13:96120188-96120210 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1113032605 13:106010882-106010904 TCTTGCTTCTATCCAGCTTCTGG - Intergenic
1113367852 13:109693411-109693433 CCCTGCCTCTCTCCAGCTTCTGG - Intergenic
1113679931 13:112236188-112236210 CTGTGTTTCTTCCTAGCTTCTGG - Intergenic
1114435470 14:22702933-22702955 CCTTGTTCCTGTCTTCCTTCTGG - Intergenic
1114602472 14:23967771-23967793 CCCTGCCTCTCTCTACCTTCTGG + Intronic
1114606841 14:24004897-24004919 CCCTGCCTCTCTCTACCTTCTGG + Intronic
1114612141 14:24049845-24049867 CCCTGCCTCTCTCTACCTTCTGG + Intergenic
1115039262 14:28901857-28901879 CCTTGCCTCTTTCTAGCCTCTGG - Intergenic
1115324663 14:32126336-32126358 CCTTGCCTCTTTCTTGCTTCTGG + Intronic
1115502837 14:34064614-34064636 CCTTGCTTCTTCCTAGCTTTTGG - Intronic
1116420780 14:44729264-44729286 CCTTATTTCTCTCTTTCTTTGGG - Intergenic
1117580881 14:57150625-57150647 CCTTGCCCCTCCCTAGCTTCTGG + Intergenic
1117599616 14:57361963-57361985 CCTTGCCACTCTCTAGCTTCCGG - Intergenic
1118916616 14:70112774-70112796 CCTTGCTTCTTCCTAGCTTCTGG + Intronic
1119012108 14:71004256-71004278 ACTTGTTTCTCCCTAGATTAGGG - Intronic
1119479600 14:74951287-74951309 CCTTGTTTCCCACTGGGTTCCGG - Intronic
1119955998 14:78798966-78798988 CATTGTTTCCTCCTAGCTTCTGG + Intronic
1119964566 14:78899940-78899962 CCTTTTTTTTCTCTTCCTTCTGG + Intronic
1120065488 14:80035965-80035987 CCTTGTTTCGCTTTGGCATCAGG - Intergenic
1120800156 14:88678980-88679002 CCTTGTTTCTCTCTAGCTTCTGG + Intronic
1122083869 14:99286014-99286036 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1122202188 14:100129368-100129390 CCTTGTCCCTCTCTCGATTCTGG + Intronic
1122351968 14:101101543-101101565 CCAGGCTTCTCTCCAGCTTCTGG - Intergenic
1124111685 15:26795893-26795915 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1125309102 15:38359264-38359286 CCTTTTTTCTCTCTGCCTTGAGG + Intergenic
1125611903 15:40977067-40977089 CCTCATTTCTTTCTTGCTTCAGG - Intergenic
1125967667 15:43887309-43887331 AGTTGCTTCTCTCTAGGTTCAGG + Intronic
1126049015 15:44670057-44670079 CCTGCTTCTTCTCTAGCTTCTGG + Exonic
1128779012 15:70345656-70345678 CCTTGTTTCTCACTTGGTTATGG + Intergenic
1129043943 15:72716351-72716373 CCCTGTTTCTCTCTAAACTCAGG + Intronic
1129958842 15:79664845-79664867 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1131607924 15:93928494-93928516 CCTTTTATACCTCTAGCTTCTGG + Intergenic
1132286905 15:100670004-100670026 CCAGGCCTCTCTCTAGCTTCGGG + Intergenic
1134077496 16:11302201-11302223 CCATGCCTCTCCCTAGCTTCTGG + Intronic
1135239079 16:20787269-20787291 CCATCTTTCTCTCTAGATGCTGG - Intronic
1136040659 16:27576189-27576211 CTCTGTCTCTCTCTAGCTACGGG + Intronic
1138304861 16:55965303-55965325 CCTTGCCTCTTTCAAGCTTCTGG + Intergenic
1138476798 16:57275554-57275576 CCTTTTTTCTTTCTGGGTTCTGG - Intronic
1138505593 16:57476793-57476815 CCTACATTCTCTGTAGCTTCAGG + Intronic
1138613766 16:58148111-58148133 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
1140309479 16:73835274-73835296 ACATGTCTCTCTCTAGCTTTGGG + Intergenic
1140891946 16:79292366-79292388 CCTTGCCTCTAACTAGCTTCTGG - Intergenic
1142355597 16:89600151-89600173 CCTTGTTTCTTCCTGGCTTGAGG + Intergenic
1143998834 17:11033733-11033755 CCTTGTTTCTCTTTGGGTTTTGG - Intergenic
1144137280 17:12308735-12308757 TGTTGTTTGTTTCTAGCTTCTGG + Intergenic
1144159711 17:12545875-12545897 ACTTGCTTCTTTCTCGCTTCTGG + Intergenic
1144450847 17:15377167-15377189 CCTTGTTTCTACCTAGACTCTGG + Intergenic
1146147684 17:30435841-30435863 CCTTGTTTCTCCCTAGTTTCTGG + Intronic
1147463773 17:40594329-40594351 CCTTGGTTATCTCTATCTTTAGG - Intergenic
1148368602 17:47075993-47076015 CCTTGTCTTTTTCCAGCTTCTGG - Intergenic
1148463665 17:47851784-47851806 CCTTTTTTCCCTCTCCCTTCCGG + Intronic
1148667438 17:49385117-49385139 CCTTGGTCCTCTCTTCCTTCTGG - Intronic
1150976317 17:70091035-70091057 CCTTGTTTCTTTCTCCCATCTGG + Intronic
1151065744 17:71147813-71147835 CCTTTTTCCTCTCTGGCTTTTGG + Intergenic
1152004680 17:77672688-77672710 CCATGTTCTTCCCTAGCTTCTGG - Intergenic
1152729954 17:81964951-81964973 CCCTGTTTCTCTCCATCTCCTGG - Intergenic
1152818054 17:82420432-82420454 CCTTGCTTCTCTCTAGCTTCTGG - Intronic
1153519251 18:5936803-5936825 CCTCTTTCCTCTCTAGCTACAGG - Intergenic
1153853894 18:9125773-9125795 CTTTGTTTCTCTCCTGCTCCTGG + Intronic
1156767539 18:40675939-40675961 CCTAGTTTCTCTCTATATTATGG + Intergenic
1156815257 18:41302705-41302727 TCTTGTCTTTCGCTAGCTTCAGG + Intergenic
1156917082 18:42474339-42474361 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
1157367390 18:47078087-47078109 CATTATTTCTTTCAAGCTTCAGG + Intronic
1157738635 18:50072873-50072895 CCTGGTTGCTCTCCTGCTTCTGG - Intronic
1158048677 18:53188776-53188798 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1158077961 18:53553191-53553213 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1158467206 18:57701486-57701508 TAGTGGTTCTCTCTAGCTTCTGG + Intronic
1158545539 18:58393147-58393169 CCATGTTTCTCTGTGACTTCAGG + Intronic
1158795522 18:60841186-60841208 CCATGTTTCTCCCTAGTTTCTGG - Intergenic
1158915999 18:62130085-62130107 CCTTGCCTCTACCTAGCTTCTGG - Intronic
1159041308 18:63325469-63325491 TCTTGCCTCTCCCTAGCTTCTGG + Intergenic
1159389635 18:67773056-67773078 CCTTGTCTCTCTCTTGTTACAGG + Intergenic
1159869813 18:73747759-73747781 CTTTGTTCCCTTCTAGCTTCTGG + Intergenic
1160415392 18:78706384-78706406 CCTGGGCTCTCTCTGGCTTCCGG - Intergenic
1161729743 19:5952039-5952061 CCTGGTTTCTCCCTAACTTTGGG - Intronic
1162119152 19:8451429-8451451 CCTATTTTCTCACTATCTTCAGG - Intronic
1162148443 19:8628258-8628280 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
1165290915 19:34885003-34885025 CTCTTTTTCTCTCTTGCTTCTGG - Intergenic
1165298545 19:34949910-34949932 CCTTGTTTCTCTCTTTCCTCTGG - Intergenic
1165741331 19:38206876-38206898 CCTTGCCTCTCTCTATCCTCAGG - Exonic
1165956914 19:39506923-39506945 CCCTTTTTCTCTCTAACTTAAGG - Intronic
1166007840 19:39919303-39919325 CCTTTTTTTTCTATAGCATCTGG + Intronic
1166566668 19:43769769-43769791 CCTTGTTAAACTCCAGCTTCCGG + Exonic
925749018 2:7070795-7070817 CTTGGCTTCTCCCTAGCTTCTGG - Intergenic
926587648 2:14706101-14706123 TCATGGTTCTCTCCAGCTTCTGG + Intergenic
926705618 2:15835397-15835419 CCTTGCCTCTCCCCAGCTTCTGG + Intergenic
928227174 2:29460706-29460728 CCATTTTTCTCCCTATCTTCAGG + Intronic
928906954 2:36378341-36378363 ACATGTTTCTCTCTAGCTGCGGG + Intronic
929558626 2:42941720-42941742 CCTTGCTTCTCTCTTGATTTTGG + Intergenic
930999665 2:57765038-57765060 CCATGTTTCTCTCCATCGTCAGG + Intergenic
931902670 2:66806862-66806884 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
933233437 2:79836631-79836653 CCTTGCTTCTTCCTAGCTCCTGG + Intronic
933314519 2:80700168-80700190 CTTTGATTCTTTCTAGTTTCAGG + Intergenic
934908879 2:98232368-98232390 CCTTTTTTCTATCTAGCTAGAGG + Intronic
935358780 2:102229850-102229872 ACTTGTTGCTCTCCAACTTCAGG - Intronic
935853490 2:107248897-107248919 GCATGTTTCTCTCTGGGTTCTGG + Intergenic
936519718 2:113204101-113204123 GCTTGCATCTTTCTAGCTTCTGG + Intronic
936934761 2:117828450-117828472 CCTATTTTCTCTCTAGCACCTGG + Intronic
937333616 2:121047181-121047203 CATTGTTTCTCTCCAGGTACAGG + Intergenic
939042087 2:137201995-137202017 ACTTGATTCTCTATAGATTCTGG + Intronic
939542122 2:143507327-143507349 CCTTATTTCTTTCTAACTCCTGG - Intronic
939662691 2:144910036-144910058 CCTTGTCTCTTACTAGCTTTGGG + Intergenic
939675242 2:145064037-145064059 CCTTTTTTCTCTCTCTCTTTTGG - Intergenic
939870186 2:147518183-147518205 CCATGTCTTTCTCTAACTTCTGG + Intergenic
940004165 2:148996434-148996456 TCATGTTTCTCTCTTGCATCCGG + Intronic
940074975 2:149731621-149731643 CCTTGCTTCTTCCTAGCTTCTGG + Intergenic
940179343 2:150914547-150914569 CCTTGCCTCTCTCTGGCTTCTGG + Intergenic
940556900 2:155240273-155240295 CTTTTTTTCTCACTAGATTCAGG - Intergenic
940791868 2:158037567-158037589 CCATGCCTCTCTTTAGCTTCTGG + Intronic
940962368 2:159799630-159799652 TCTTGTTTGCCTCTAGGTTCTGG - Intronic
941043053 2:160644856-160644878 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
942385484 2:175438545-175438567 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
944448134 2:199812714-199812736 CCTTGTTTTTAGCTTGCTTCAGG - Intronic
945549687 2:211205381-211205403 CCAGGTTTGTCTCCAGCTTCTGG + Intergenic
945620335 2:212127848-212127870 CCTTGCCACTCTCTAGCTTCTGG - Intronic
946032196 2:216714160-216714182 CTTTGATTTTCTCTAGCATCTGG + Intergenic
946184306 2:217970139-217970161 CCTTGCCTCTTTCCAGCTTCTGG - Intronic
947412772 2:229858999-229859021 CCTTGTTTCACTCTGGCACCTGG + Exonic
1168746055 20:241950-241972 TTTTGTTTCTCTCTTGTTTCTGG + Intergenic
1169157310 20:3342611-3342633 CCTTGTTTGCCTGTAGCTTAAGG - Intronic
1169215014 20:3788195-3788217 CCTGGTTTTTCTCCTGCTTCAGG - Intronic
1169396368 20:5234001-5234023 CCTCCCCTCTCTCTAGCTTCTGG - Intergenic
1169792986 20:9431148-9431170 CCTTGCCTCTTTCTGGCTTCTGG + Intronic
1170526951 20:17248542-17248564 CCTTTTTTGTCTCTTGCTTTTGG - Intronic
1170848827 20:19985183-19985205 CCTTGTCTATCTCCAGCCTCTGG + Intronic
1171254884 20:23682981-23683003 CAATGTTTCTCTCAAGCTGCAGG + Intergenic
1172671036 20:36634578-36634600 CCTTGCTTCTCTCTAGATGGAGG + Exonic
1172909638 20:38398244-38398266 TCTTGTTTCTCTCTATGCTCTGG + Intergenic
1173961574 20:47076750-47076772 CTTAGTTTCTCTCTTCCTTCTGG + Intronic
1174455952 20:50648998-50649020 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1175203372 20:57292725-57292747 CCTTCTTTCTCCCCAGCCTCAGG + Intergenic
1175371105 20:58493430-58493452 TCTCGTTTGTCTCTAGCTTTTGG - Intronic
1175438031 20:58968328-58968350 CCTTTTTTCTCTTTCACTTCAGG - Intergenic
1175524061 20:59621485-59621507 CCCCGTTTCTCTCTTTCTTCTGG + Intronic
1175755488 20:61527041-61527063 CGTGGTGTCTCTCTAGCTTTGGG + Intronic
1176231933 20:64037241-64037263 CCTTCCTCCTCTATAGCTTCTGG + Intronic
1176788550 21:13290003-13290025 CTATGTCTCTCTCTTGCTTCAGG - Intergenic
1177208909 21:18045505-18045527 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1177528160 21:22325179-22325201 CCCTGTTTCTCTCTTGTCTCAGG - Intergenic
1178211286 21:30535841-30535863 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
1178352233 21:31880444-31880466 CCTTGCCTCTTACTAGCTTCCGG + Intronic
1178440112 21:32591726-32591748 CCTGATTTCTCTCCAGCTCCAGG - Intronic
1178818194 21:35950782-35950804 CCATGCCTCTTTCTAGCTTCTGG + Intronic
1178990468 21:37351045-37351067 CCTTGTTTCCTTCTAACTCCCGG - Intergenic
1179335870 21:40452986-40453008 CCATGTTTCTGTCTAGCAGCAGG - Intronic
1180196193 21:46195750-46195772 CCCTGTTTCCCTCCAGCTCCTGG - Exonic
1180733120 22:17996800-17996822 CCTTTTTGGTCTTTAGCTTCCGG - Intronic
1182471333 22:30550125-30550147 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1182508697 22:30803397-30803419 CCTTGTGACTGTCTGGCTTCTGG - Intronic
1183311927 22:37114715-37114737 CCTTGTCTCTTGCTAGCTTTCGG + Intergenic
1184975226 22:48057136-48057158 CCTTCTCTCTCTCTCTCTTCAGG - Intergenic
1185383311 22:50520333-50520355 CCTTGACTCTCTCTAGGCTCAGG + Intronic
949369980 3:3324403-3324425 CCTTGCCTCTCCCTAGCTTCTGG - Intergenic
949386490 3:3508132-3508154 CTTTCTTTCTCTCAGGCTTCTGG - Intergenic
949389318 3:3541757-3541779 CCTTGTCTCTTCCTAGCTTCTGG + Intergenic
949558025 3:5175723-5175745 CCTTGCCTCTCTCTAGCTTGTGG + Intronic
950562117 3:13737403-13737425 CTGTGTTTCTCTCTCTCTTCTGG + Intergenic
951554838 3:23910773-23910795 TCTAGTTTGTCTCTAGGTTCTGG - Intronic
951661353 3:25070065-25070087 CCTTGGCTCTTCCTAGCTTCTGG + Intergenic
951810580 3:26694680-26694702 ACTTGATTTTATCTAGCTTCAGG + Intronic
952173941 3:30841145-30841167 CATTTTTTCTCAGTAGCTTCAGG - Intronic
953051168 3:39345294-39345316 CCTTGACTCTTCCTAGCTTCTGG - Intergenic
953457810 3:43056473-43056495 CCTTGTGCCCCTCTGGCTTCTGG - Exonic
953462226 3:43090603-43090625 TCTGGTTTCTTTCTAGCTCCTGG - Intronic
953728598 3:45424901-45424923 CCTTTTTATTCTCTACCTTCTGG + Intronic
954858743 3:53669591-53669613 CCTTGCTTCTCACTAGTGTCTGG + Intronic
956070295 3:65442239-65442261 CTTTGTTTCTCTCTTGCCTGAGG - Intronic
956116315 3:65922526-65922548 CCTTGTCTCTTTCTAGCTTCTGG - Intronic
956964591 3:74444003-74444025 CCTTGCCTTTTTCTAGCTTCTGG + Intronic
957037268 3:75305935-75305957 CTTTGTCTCTTCCTAGCTTCTGG + Intergenic
958024728 3:88037505-88037527 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
959379780 3:105628186-105628208 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
959764396 3:110008039-110008061 CCTTGATTCTTTCCAGCTTCTGG + Intergenic
959873459 3:111354592-111354614 CTTTGCCTCTTTCTAGCTTCTGG - Intronic
959968929 3:112386302-112386324 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
960683345 3:120272430-120272452 CATTGTGTCTCTCTTGCTTTTGG - Intronic
960995487 3:123337528-123337550 CCTTGTGTATTCCTAGCTTCTGG + Intronic
961821017 3:129575671-129575693 CCCTGCCTCTCTCTACCTTCTGG - Intronic
962046842 3:131769268-131769290 GGTTGTTTCTCTCAAGGTTCTGG + Intronic
962686833 3:137856056-137856078 CCTTGCCTCTTTCTGGCTTCTGG + Intergenic
962750505 3:138431636-138431658 CCTTGCTTCTTTCCAGCTCCTGG + Intergenic
964221009 3:154344735-154344757 TCTTGCCTCTCCCTAGCTTCTGG - Intronic
964251708 3:154725458-154725480 TCTAGTCTCTTTCTAGCTTCCGG + Intergenic
964348811 3:155782299-155782321 GCTTGTTTCTCTTTTTCTTCTGG - Intronic
964481282 3:157140948-157140970 CCTTGTTTCTTTGTAGTTTCTGG - Intergenic
965002887 3:162980512-162980534 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
965042337 3:163525866-163525888 CCTTCTTTCTCTGTTGCTTCAGG + Intergenic
965312003 3:167140000-167140022 CCTTTCTTCCTTCTAGCTTCTGG - Intergenic
967074831 3:185992651-185992673 CTTGGTTTTTCTCTAGCTGCTGG + Intergenic
967660922 3:192108901-192108923 CCTTGCTTCTTCCTAGCTTCTGG + Intergenic
967835545 3:193959507-193959529 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
969359165 4:6650744-6650766 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
969468946 4:7375108-7375130 CCTTGTCTAACTCTGGCTTCTGG + Intronic
969973016 4:11067358-11067380 CCTTGTCTCTTTTTAGCTGCTGG + Intergenic
970239121 4:13989665-13989687 CCTTGCCTCTTTCTAGCTTCCGG + Intergenic
970314780 4:14818816-14818838 CCTTGTCTCTTTCTAGCTTCTGG - Intergenic
970362305 4:15322243-15322265 CCTTGTCTTTTTTTAGCTTCTGG + Intergenic
970386524 4:15562373-15562395 CTTTGTTTCTGTTTAGTTTCTGG + Intronic
970638879 4:18041284-18041306 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
971259921 4:25046782-25046804 CCATGCCTCTCCCTAGCTTCTGG + Intergenic
971451683 4:26806881-26806903 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
971474018 4:27055730-27055752 CCTTTTCTCTCTCTCTCTTCAGG - Intergenic
971698665 4:29938676-29938698 TATTCTTACTCTCTAGCTTCTGG - Intergenic
972369283 4:38407176-38407198 CCTTGCCTCTTGCTAGCTTCTGG - Intergenic
972605480 4:40609722-40609744 CCTCATCTCTCTCTAGGTTCCGG + Intronic
974384748 4:61189938-61189960 CCTTGTCTCTTCCCAGCTTCTGG - Intergenic
975688663 4:76944502-76944524 TCTTATTTTTCTCTGGCTTCTGG - Intergenic
975701519 4:77071467-77071489 CCTTGCTTCTGTCTTGCTTTAGG - Intronic
977987894 4:103406232-103406254 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
979031302 4:115651635-115651657 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
980079571 4:128329785-128329807 CCTGGTTTCTCCCCAACTTCGGG - Intergenic
980238900 4:130147408-130147430 CTTTGCTTCTCTCTAAATTCTGG - Intergenic
981102853 4:140849603-140849625 CCGTGCCTCTCCCTAGCTTCTGG + Intergenic
981187664 4:141823140-141823162 CCTTTTTTCTCTCTCTCTTCTGG - Intergenic
981249827 4:142586393-142586415 CTTTGTCTCTCTCTTGCCTCTGG - Intronic
982635195 4:157887135-157887157 CCTTGTCTCTTCCTGGCTTCTGG - Intergenic
982659279 4:158187683-158187705 CCTTGCCTTTCCCTAGCTTCTGG - Intergenic
983141703 4:164157615-164157637 CTTTGTCTCTGTCTAGCATCTGG + Intronic
983380391 4:166984282-166984304 CCTTGGTTCTCACTAGATTCTGG - Intronic
984089195 4:175349596-175349618 TCTTATTTCTCTCTGGCTTAGGG - Intergenic
984877531 4:184382748-184382770 CCTTCTTTCCCTCTAACTGCTGG + Intergenic
987067602 5:14304650-14304672 ACTTTTTTTTTTCTAGCTTCCGG - Intronic
987428371 5:17799746-17799768 CCTTGTTGCTATCTTGTTTCAGG + Intergenic
988801382 5:34699393-34699415 CCGTGTCTCTCCCCAGCTTCTGG + Intronic
988802559 5:34710243-34710265 CCTTGCTTATTCCTAGCTTCTGG + Intronic
989192922 5:38689006-38689028 TTTTGTTTGTCTCCAGCTTCTGG + Intergenic
989268438 5:39504244-39504266 CCATGTCTCTCTCTAGCTTCTGG + Intergenic
991072673 5:62502137-62502159 CCCTGTTTCTCTCATGCTTTGGG + Intronic
993210390 5:84942476-84942498 CCTTTCTTTTCTCTAACTTCTGG + Intergenic
993363458 5:87006040-87006062 TCTTCCTTCTCTCTAGCTTTTGG - Intergenic
993567164 5:89490051-89490073 CCTTGGCTCTTTCTAGCTTCTGG - Intergenic
994376362 5:99019390-99019412 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
994621965 5:102174476-102174498 CCTGGTGTCTCTCTTTCTTCTGG + Intergenic
995005472 5:107189343-107189365 CCTTGTTACTCTTTAGTATCAGG - Intergenic
995353058 5:111204475-111204497 TCTTGTTTCTCTCTCTCTTATGG + Intergenic
995516169 5:112955974-112955996 ACTTTATTTTCTCTAGCTTCAGG - Intergenic
996058174 5:119003015-119003037 CCTTCTTTCTCTCAACCTCCAGG + Intergenic
996272817 5:121628906-121628928 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
996399016 5:123039710-123039732 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
996424232 5:123295160-123295182 CCTTCCTACTCTCTACCTTCTGG - Intergenic
997751152 5:136347084-136347106 CCTTGTCTCTTCCTAGTTTCTGG - Intronic
998748633 5:145291446-145291468 CCTTGCCTCTTTCTAGCTCCTGG - Intergenic
999105701 5:149069071-149069093 CCTTGTCTTTTTCTAGTTTCTGG - Intergenic
999632278 5:153583411-153583433 CCTTGACTCTTCCTAGCTTCTGG + Intronic
999842244 5:155440703-155440725 CCTTGTTTCAATCTAGTTTTAGG + Intergenic
999977848 5:156929615-156929637 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1000621907 5:163495488-163495510 CTTTGTTCCTGTCTAGTTTCAGG + Intergenic
1000991296 5:167914730-167914752 CCTTGTCTCTCCCTAGCTTCTGG + Intronic
1001183852 5:169547923-169547945 CTTTTTTGCTATCTAGCTTCTGG - Intergenic
1001801292 5:174546463-174546485 TCTTGTTTCTGTCTAGCCTTTGG - Intergenic
1002398025 5:178972912-178972934 TCCAGTTTCTCTCTAACTTCAGG + Intergenic
1002398183 5:178974103-178974125 TCCAGTTTCTCTCTAACTTCAGG - Intergenic
1002764312 6:226209-226231 CCCTGTGTCTCTGTGGCTTCGGG + Intergenic
1003529530 6:6926468-6926490 CCTTGTTTCTCTATTGCAGCAGG - Intergenic
1003866974 6:10372200-10372222 CCTTGTCTCTTCCTAACTTCTGG + Intergenic
1005133369 6:22538041-22538063 CCATGTGTCTCTGTAGTTTCTGG - Intergenic
1005346761 6:24898016-24898038 CCTTCTTTCTTTCTTTCTTCAGG - Intronic
1005617123 6:27584371-27584393 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1006339153 6:33436938-33436960 CCTTGCCTCTTCCTAGCTTCCGG + Intronic
1007466893 6:42058834-42058856 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1007521674 6:42454788-42454810 CCTTCCTTCTCTGCAGCTTCTGG - Intergenic
1010025358 6:71209388-71209410 CCTCCTGTCTCTCTAGATTCAGG - Intergenic
1010720120 6:79273856-79273878 CCTTCTTTCTCTCTCAATTCTGG - Intergenic
1010977207 6:82329376-82329398 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1011684109 6:89810569-89810591 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1011709506 6:90037963-90037985 CCTTCCTTCTTCCTAGCTTCTGG - Intronic
1013931508 6:115539858-115539880 CCTTGTTTCTTCCTAGTTTCTGG - Intergenic
1014754758 6:125290707-125290729 CCTTGCCTCTTTCTAGCTTTTGG - Intronic
1015008176 6:128310160-128310182 CCTTCTTTCTCTCTGATTTCTGG + Intronic
1015286620 6:131492564-131492586 TCTTGCCTCTCTATAGCTTCTGG - Intergenic
1015442622 6:133266354-133266376 CTTTGTCTCTCCCCAGCTTCTGG - Intronic
1015859195 6:137657498-137657520 CCTGGTCACTCTCTAGCTTCTGG + Intergenic
1016118659 6:140320337-140320359 CTTTGTTTATCTCTAGCACCTGG + Intergenic
1017202717 6:151773263-151773285 GCATGCTTCTCTGTAGCTTCTGG - Intronic
1017618621 6:156272420-156272442 CCTGCTTTCTCTATAGCTACAGG - Intergenic
1018349358 6:162940681-162940703 CCTTGTTTCTCACCAGCAGCAGG + Intronic
1020732179 7:11894007-11894029 CCTTATTTCTTCCTAGCTTCTGG + Intergenic
1020753798 7:12175312-12175334 CCTTAGTTTTCTCTAGCTTATGG - Intergenic
1020961348 7:14807188-14807210 TTTTGTTTCTCTCTAACTGCAGG + Intronic
1021077267 7:16320204-16320226 TCTTGTTTCTCTCTTGTTTCTGG - Intronic
1021593753 7:22293169-22293191 CCAAGTATCTCTCTAGCTTCTGG + Intronic
1022581225 7:31556948-31556970 CCTGGTTTCTTTCTAGTTTCTGG + Intronic
1024425430 7:49220089-49220111 CCTTCTTCCTCCCTAGCCTCAGG - Intergenic
1025148984 7:56531692-56531714 CCTTCTTCCTCTCAAACTTCTGG - Intergenic
1026846347 7:73700925-73700947 CCCTTTTTGTCTCTAGCCTCAGG - Intronic
1028405720 7:90471715-90471737 ACTTGTTTCTCTCCAGATTTGGG - Intronic
1028555143 7:92115491-92115513 CCTTGCATCTTCCTAGCTTCTGG - Intronic
1029164232 7:98575302-98575324 CATTGTTTCTCTTTGCCTTCTGG + Intergenic
1029602035 7:101571974-101571996 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
1030412856 7:109203592-109203614 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1032783284 7:135181591-135181613 CCTTCTTTAACTCTAACTTCAGG - Intergenic
1033414445 7:141149756-141149778 CCTTGTCTCTTCCCAGCTTCTGG - Intronic
1033592810 7:142827534-142827556 CCTTGTCTCTCTCCCCCTTCTGG - Intergenic
1034083265 7:148300260-148300282 CTTTGTTTCTCTCTAACATAAGG - Intronic
1034287692 7:149899683-149899705 CCTTCTTTCTCTTTTCCTTCTGG - Intergenic
1034663436 7:152793238-152793260 CCTTCTTTCTCTTTTCCTTCTGG + Intronic
1034888141 7:154814747-154814769 CCACGTTTCTCTCGAGCTTCTGG + Intronic
1037676102 8:21051945-21051967 CCTTGCTTCTCCATAGCCTCTGG + Intergenic
1038080372 8:24128273-24128295 CCTTGTTTCTTAATATCTTCAGG - Intergenic
1038607011 8:29017032-29017054 CCTTGTTTCTGTCTATCACCTGG + Intronic
1039299599 8:36195115-36195137 CCTGGTTTCTCTCTGGCTTCAGG - Intergenic
1039381907 8:37093317-37093339 CCTTGGCTCTTCCTAGCTTCTGG + Intergenic
1039850177 8:41358184-41358206 CCTTTTTTCTTTTTAGCCTCAGG + Intergenic
1041046319 8:53890061-53890083 CTTTCTTTCTCTCCTGCTTCTGG + Intronic
1041139179 8:54796659-54796681 CCTTGCCTCTTTCTAGCTCCTGG - Intergenic
1042029254 8:64456900-64456922 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1042315036 8:67417221-67417243 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1042611550 8:70607362-70607384 CCTTGTTTCTTTAAAGCGTCAGG + Intronic
1043924804 8:86024852-86024874 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1044245689 8:89942255-89942277 CCTTCATTCACTCCAGCTTCTGG + Intronic
1044605879 8:94046864-94046886 CCTTCTTCCTCTCTAACCTCTGG + Intergenic
1044610672 8:94088830-94088852 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1044688958 8:94857619-94857641 CCTTGCGTCTTCCTAGCTTCTGG + Intronic
1044810774 8:96058972-96058994 CCTTGATTATCTCTGGCCTCAGG + Intergenic
1045176920 8:99735529-99735551 CCTTGTCTCTTCCTAGTTTCTGG - Intronic
1046194319 8:110839005-110839027 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
1047395818 8:124498091-124498113 CCTTTTTTCTTTCATGCTTCTGG + Intronic
1047619796 8:126594781-126594803 CCTTGGTTCTTCCTAGCTTCTGG - Intergenic
1048217920 8:132513706-132513728 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1048380076 8:133857784-133857806 CCTTATCTCTTCCTAGCTTCTGG + Intergenic
1049010236 8:139882503-139882525 CCTTGTTTCACTGCAGCCTCTGG - Intronic
1049131916 8:140853041-140853063 CCTGTTTTCTCTCTAGGGTCTGG + Intronic
1050094790 9:2052879-2052901 ACTTTTTTCTTTCTAACTTCTGG - Intronic
1051686617 9:19664825-19664847 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1052347292 9:27422871-27422893 GCTTTTTTCTGTCTAGATTCAGG - Intronic
1052921338 9:33972509-33972531 CTTTGTCTCTCTCTAACTTCAGG - Intronic
1053098005 9:35345927-35345949 CCTTGTATATGTCTAGCTTCTGG + Intronic
1053403665 9:37851388-37851410 CCGTGTTGGTCTCTAACTTCTGG + Intronic
1054741819 9:68813810-68813832 CCTTGCTACTTTTTAGCTTCTGG - Intronic
1055380235 9:75698747-75698769 CCTTGGCTCTTCCTAGCTTCAGG + Intergenic
1055710456 9:79055228-79055250 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1055751709 9:79513855-79513877 CCTTGCCCCTCTCTTGCTTCTGG - Intergenic
1056343573 9:85665347-85665369 CCTTGCTTCTTCCTAGCTTCTGG - Intronic
1057540280 9:95961381-95961403 CCTTGCCTCTTTCTAGCTTCTGG - Intronic
1058349990 9:104010036-104010058 CCTGGTTTCTCTCTCTCTCCTGG + Intergenic
1058553372 9:106139516-106139538 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
1058662101 9:107275949-107275971 CCTCATCTCTTTCTAGCTTCTGG - Intergenic
1059033252 9:110723978-110724000 CCATCTTTCTCTCTGGCCTCAGG + Intronic
1059199468 9:112400740-112400762 CCTTGCTTCTTCCCAGCTTCTGG + Intronic
1059263588 9:113004187-113004209 CTTTGCTTCTCCCTAGCTTCAGG - Intergenic
1060007984 9:120017239-120017261 CCTTGCCTCTCCCTAGCTTCCGG + Intergenic
1060923276 9:127437669-127437691 CCTTGCCTCTTTCTAGTTTCCGG + Intronic
1061247819 9:129410125-129410147 CCAGGCTTCTCTCCAGCTTCTGG - Intergenic
1062283703 9:135763567-135763589 CCATGCCTCTCTCCAGCTTCTGG + Intronic
1186317648 X:8387991-8388013 CCTTCACTCTCTCTTGCTTCCGG + Intergenic
1186399422 X:9243003-9243025 CCATGCCTCTCTCCAGCTTCTGG + Intergenic
1186902175 X:14068461-14068483 CCTGGTCTCTTTCTAGCTTCTGG + Intergenic
1187117669 X:16369880-16369902 CCTTGCGTCTTCCTAGCTTCTGG + Intergenic
1187865610 X:23720602-23720624 CCTTGTCTGTTTCTTGCTTCTGG - Intronic
1187928336 X:24271028-24271050 CTTTGCTTCTTTCTAGCTTCTGG + Intergenic
1189360777 X:40349207-40349229 CCTTGCCTCTTTCTAGTTTCTGG + Intergenic
1190461823 X:50684348-50684370 CCTTGATTCTTCCTAGCTTCTGG - Intronic
1190529074 X:51356805-51356827 CTTTCCTTTTCTCTAGCTTCAGG - Intergenic
1193405616 X:81097581-81097603 CCTTTTTTCTCTCTCTCTTCTGG - Intergenic
1194091480 X:89584818-89584840 CCTTGGTTCTCATTAGCCTCGGG + Intergenic
1194140529 X:90203615-90203637 CTTTCTTTCTCTTTACCTTCTGG + Intergenic
1194140549 X:90203742-90203764 CCTTCTTTCTCTTTACCTTCTGG + Intergenic
1194884751 X:99299840-99299862 TTATTTTTCTCTCTAGCTTCAGG - Intergenic
1194890799 X:99376087-99376109 CCTTGGTTCTTCTTAGCTTCTGG + Intergenic
1195525118 X:105879011-105879033 CCTTGTCTCTTCCTGGCTTCTGG + Intronic
1196963842 X:121033663-121033685 CCTTGTCTCTTTCTAGCTTCTGG - Intergenic
1197291742 X:124666753-124666775 CTTTGTTTCTAGCTAGTTTCAGG - Intronic
1197977191 X:132178615-132178637 CCTTGTTTCTTTGAAGCTTCTGG + Intergenic
1198852978 X:140985626-140985648 CCTTGTCTCTTCTTAGCTTCTGG + Intergenic
1199133296 X:144220155-144220177 CTTTGTCTCTATCTATCTTCAGG + Intergenic
1199384244 X:147205558-147205580 ACTTGTTTCTTTGTAGATTCTGG - Intergenic
1199689804 X:150300211-150300233 TCTTGTATCTCTTCAGCTTCTGG + Intergenic
1199726095 X:150582717-150582739 CCTTGCCTCTCCCTAGCTTCTGG - Intronic
1199791299 X:151157650-151157672 CCTTGCCTCTCCCTAGCTACTGG + Intergenic
1199903352 X:152199454-152199476 CCTTGCCTCTCCCTAGTTTCTGG - Intronic
1200331129 X:155299221-155299243 CCATGTTTGTCTCTAGCAACTGG - Intronic
1200444120 Y:3240880-3240902 CCTTGGTTCTCATTAGCCTCGGG + Intergenic
1200486270 Y:3772554-3772576 CTTTCTTTCTCTTTACCTTCTGG + Intergenic
1200486288 Y:3772691-3772713 CCTTCCTTCTCTTTACCTTCTGG + Intergenic
1200486308 Y:3772847-3772869 CCTTCTTTCTCTTTACCTTCTGG + Intergenic
1200982087 Y:9271794-9271816 CCATGTTTCTCTCCAGCCTAGGG - Intergenic
1201267065 Y:12217439-12217461 CTTTGTTTCTTTCTTGTTTCTGG + Intergenic
1202128320 Y:21587937-21587959 CCATGTTTCTCTCCAGCCTAGGG + Intergenic