ID: 1120806077

View in Genome Browser
Species Human (GRCh38)
Location 14:88752622-88752644
Sequence AATACTGGGTAGAAGAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 2, 1: 7, 2: 23, 3: 75, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120806067_1120806077 24 Left 1120806067 14:88752575-88752597 CCATTACCAGAAAGTCATCTCTT 0: 1
1: 0
2: 2
3: 36
4: 362
Right 1120806077 14:88752622-88752644 AATACTGGGTAGAAGAAGGTGGG 0: 2
1: 7
2: 23
3: 75
4: 371
1120806068_1120806077 18 Left 1120806068 14:88752581-88752603 CCAGAAAGTCATCTCTTACTAAT 0: 1
1: 0
2: 4
3: 22
4: 193
Right 1120806077 14:88752622-88752644 AATACTGGGTAGAAGAAGGTGGG 0: 2
1: 7
2: 23
3: 75
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120806077 Original CRISPR AATACTGGGTAGAAGAAGGT GGG Intronic
901549986 1:9989007-9989029 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
901649380 1:10734902-10734924 ATTACTGGAGAGAAGAGGGTGGG + Intronic
902324954 1:15693841-15693863 AGTTGTGGGGAGAAGAAGGTTGG + Intronic
904382901 1:30123541-30123563 AATACTGGATGGAAGAAAGAAGG + Intergenic
904580683 1:31541645-31541667 TGTAGTGGGTGGAAGAAGGTAGG - Intergenic
904642935 1:31944390-31944412 ATAACTGGGTAGAAGGAGGCAGG + Intronic
904953061 1:34259998-34260020 AAGACTCTTTAGAAGAAGGTAGG - Intergenic
904992741 1:34606802-34606824 AATACTCAGTAGAAGGAGGTGGG - Intergenic
907458678 1:54592527-54592549 AACACTGGGGAGAGGAAAGTAGG - Exonic
907706844 1:56839747-56839769 AATACTGGGTAGAAGAGGGTGGG - Intergenic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
908716594 1:67077302-67077324 AGTACTGGGTAGAAGAAATTTGG + Intergenic
908929990 1:69306450-69306472 AGTGCTGGGTAGAAAAAGGCGGG - Intergenic
909107772 1:71434053-71434075 AATACTGGTTAGAATTATGTGGG + Intronic
909185667 1:72482218-72482240 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
910383271 1:86653760-86653782 GGGACTGGGTAGGAGAAGGTGGG - Intergenic
910587537 1:88895997-88896019 AATGCTGTGTAGTAGAAGCTTGG + Intergenic
910826788 1:91417653-91417675 AAGACTGGGGACAAGAGGGTGGG - Intergenic
911205774 1:95090357-95090379 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
911546678 1:99225375-99225397 AATACTTGGTAGAAGAGGGCGGG - Intergenic
912307603 1:108585877-108585899 AATACAGGTAAGAAGATGGTAGG - Intronic
913678788 1:121168508-121168530 TACACTGGGCAGAAAAAGGTGGG + Exonic
914030621 1:143956154-143956176 TACACTGGGCAGAAAAAGGTGGG + Exonic
914158827 1:145111808-145111830 TACACTGGGCAGAAAAAGGTGGG - Exonic
917210960 1:172631764-172631786 AATACTAGGCAGAAAAGGGTGGG + Intergenic
917589256 1:176459977-176459999 AACACGGGGTAGAAAAGGGTAGG - Intergenic
918333884 1:183488201-183488223 AATAGTTGATAGAGGAAGGTGGG + Intronic
918333902 1:183488388-183488410 AATAGTTGATAGAGGAAGGTGGG + Intronic
920466087 1:206187046-206187068 TACACTGGGCAGAAAAAGGTCGG + Exonic
921666095 1:217873497-217873519 AATACTGTGTAGGAGAAGTGTGG - Intergenic
921674964 1:217966607-217966629 AATTCTGGGCAGAGGAGGGTGGG - Intergenic
922268101 1:224006266-224006288 CATACTTGGTAGAGGGAGGTAGG - Intergenic
922876400 1:228943056-228943078 AATTCTGGGCAGAAAAGGGTGGG + Intergenic
923701065 1:236301072-236301094 AATTCTGGGCAGAAGAGAGTGGG + Intergenic
924441823 1:244092610-244092632 GAGACTGGGTAGATGGAGGTAGG - Intergenic
924902640 1:248418072-248418094 AATTCTGGGCCGAAGAGGGTGGG + Intergenic
1063526597 10:6792720-6792742 AATACTGGGAAGATGAACATGGG - Intergenic
1064162196 10:12956313-12956335 AATGCTAGGTAGAGGAAGATTGG - Intronic
1064244536 10:13658284-13658306 AAAACTGGGAAATAGAAGGTTGG + Intronic
1064785215 10:18887661-18887683 AATACTGGGTAGAAGAGGGCGGG + Intergenic
1064936106 10:20680639-20680661 AACACCCAGTAGAAGAAGGTGGG - Intergenic
1065079424 10:22112913-22112935 AATAGTTGGTAGAATATGGTAGG - Intergenic
1065762905 10:28999615-28999637 AAAAGTGGGCAGAAGAACGTGGG - Intergenic
1066535637 10:36388113-36388135 AATACTGGGCAGGAAAAGTTAGG - Intergenic
1066643263 10:37578266-37578288 AATACTGGGGAGGAAAAGTTAGG - Intergenic
1066643550 10:37581138-37581160 AATACTGGGGAGGAAAAGTTAGG - Intergenic
1066725596 10:38389343-38389365 CATACTTGGTAGAGGGAGGTAGG + Intergenic
1067211752 10:44265377-44265399 CAGATTGGGTAGAAGAAGATAGG + Intergenic
1068904476 10:62307611-62307633 AATTCTGGGCAGAAGAGGATGGG - Intergenic
1069601009 10:69708134-69708156 AATAGTGGGTATAAGAGTGTGGG + Intergenic
1070240363 10:74674157-74674179 ATTTCTGGGCAGAAGAGGGTAGG - Intronic
1070470650 10:76775717-76775739 AATTCTGGGCAGATGAAGGAGGG - Intergenic
1071083418 10:81839761-81839783 AAAACTGAGCAGAGGAAGGTGGG + Intergenic
1071353282 10:84767831-84767853 AGTGCTGGGTAGAGAAAGGTGGG - Intergenic
1071896516 10:90073891-90073913 AAAAGTGGGGTGAAGAAGGTAGG - Intergenic
1073568927 10:104559547-104559569 AATATTGGGGAGAGGAAAGTGGG - Intergenic
1074075736 10:110122589-110122611 AATAGTGGTTACAAGGAGGTGGG - Intronic
1074709998 10:116169347-116169369 AATACTAGGTAGAAGATGGTGGG + Intronic
1076601155 10:131657876-131657898 AAGCTTGGGAAGAAGAAGGTAGG - Intergenic
1078853051 11:15181413-15181435 AATACTGGGGTGAAGGGGGTGGG - Intronic
1079633190 11:22703077-22703099 AATTCTGGATAGAAAAAGGGAGG + Intronic
1079694489 11:23462876-23462898 AATAGTGGTTACAAGAAGCTGGG - Intergenic
1080486424 11:32712239-32712261 AATAGTGGTTACAAGAAGCTAGG + Intronic
1081001657 11:37680802-37680824 AACTCTGGGCAGAAGAAGGCAGG + Intergenic
1081062792 11:38501931-38501953 AATTCTGTGAAGAAGAATGTTGG + Intergenic
1081080747 11:38736505-38736527 ATTAATGGGTAGAAGAAGAATGG - Intergenic
1081737114 11:45411766-45411788 AATACTGGGAAGACAAAGGAGGG - Intergenic
1082097042 11:48139389-48139411 AATCCTGGGGATGAGAAGGTGGG - Intronic
1083102732 11:60326769-60326791 AATTCTGTGCAGAAGAAGGCAGG - Intergenic
1083179218 11:60973399-60973421 AGTACTGGGAAGGAGCAGGTCGG - Intronic
1083373853 11:62203996-62204018 AATACTAAGTAGAAGATGCTTGG + Intergenic
1084454498 11:69260231-69260253 AATTCTGGGTTTAAGAGGGTTGG - Intergenic
1084991103 11:72926128-72926150 AGTCCTGGGCAGAAGAGGGTGGG + Intronic
1085380363 11:76111526-76111548 TATACTGGGAACAAGAAGGAAGG + Intronic
1086247723 11:84774409-84774431 AATTCTGGGAAAAAGAATGTTGG - Intronic
1087261077 11:96013466-96013488 AGTACTGGGTAGAGAAAGGCAGG + Intronic
1087467450 11:98526309-98526331 AATACTGTGTAGAAGAGGGCAGG - Intergenic
1088103169 11:106176893-106176915 AGTGCTGGGTAGAGAAAGGTGGG + Intergenic
1090789431 11:130077887-130077909 AATAGTGGGTAGAAGCAGCAAGG - Intronic
1091071723 11:132571063-132571085 AAGAGTAGGTGGAAGAAGGTGGG + Intronic
1093156125 12:15688363-15688385 AGTGCTGGGTAGAGGAAGGCGGG + Intronic
1093359345 12:18203730-18203752 AATTCAGGTTACAAGAAGGTAGG + Intronic
1093401772 12:18754483-18754505 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1094412541 12:30182570-30182592 AATACTTGGTAGAAAAGGGTGGG + Intergenic
1095236187 12:39799000-39799022 GATAATGGGGAGAAGATGGTAGG - Intronic
1095243233 12:39885839-39885861 AATCCTGGGTAGGAGGAGGCTGG - Intronic
1097083574 12:56450930-56450952 CATACTGGGTCGAGGAAGGGAGG + Exonic
1097425155 12:59435476-59435498 AATAGTGGGTAGTTGCAGGTTGG - Intergenic
1099178077 12:79445452-79445474 AAGACTGGGAAGGGGAAGGTAGG - Intronic
1099895508 12:88641723-88641745 AATACTTTCTAGAATAAGGTGGG - Intergenic
1099940741 12:89185128-89185150 AATCATGGGCAGAAGAAAGTAGG + Intergenic
1100258009 12:92903904-92903926 AATTATGGGTGGAAGTAGGTGGG - Intronic
1100594629 12:96061248-96061270 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1101217399 12:102597600-102597622 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1101377628 12:104184498-104184520 AATACGAGGTAGAAAAGGGTGGG - Intergenic
1101432771 12:104640818-104640840 AATTCTGGGCAGAAGAGGGTTGG + Intronic
1103690216 12:122766465-122766487 CATACTGGGCAGCAGAAGTTAGG - Intronic
1105639683 13:22249648-22249670 AATTCTGGGCAGAAGAGGGTAGG + Intergenic
1105682709 13:22745390-22745412 AGTGCTGGGTAGAGGAAGGATGG - Intergenic
1106576342 13:30979108-30979130 AATCCTGGGTAGAAGGAAGAGGG - Intergenic
1106733372 13:32565253-32565275 AATACGTGGAAGAAGAAGGCTGG - Intergenic
1106929463 13:34648245-34648267 TATACTGAGAAGAAGAAGATGGG + Intergenic
1106977159 13:35233382-35233404 AACACTGTGTAGAAGCAGTTGGG - Intronic
1107723692 13:43276330-43276352 AATACTGGGAAAAATCAGGTTGG - Intronic
1107854092 13:44597644-44597666 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1107875124 13:44783459-44783481 AATTCTGGTCAGAAGAGGGTGGG - Intergenic
1108487635 13:50942970-50942992 AATTCTGGGCAGAAGAGGGCCGG - Intronic
1108958448 13:56189544-56189566 AATTCTGGCCAGAAGAGGGTAGG + Intergenic
1109737542 13:66506194-66506216 AATAATGCCTAGAAGTAGGTTGG + Intronic
1110159040 13:72353130-72353152 AATTCTAGGCAGAAAAAGGTAGG - Intergenic
1111034861 13:82659302-82659324 AATACTGGGTAAAAGAGGGCAGG + Intergenic
1111104718 13:83629934-83629956 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1111251965 13:85613225-85613247 AATATTGGGTAGAAGAGGATGGG - Intergenic
1111496569 13:89058237-89058259 AATCCTGCGTTGAAGAAGGGTGG + Intergenic
1111608972 13:90578732-90578754 AATAATGGGTAGAAGCTGGAAGG - Intergenic
1111695264 13:91615310-91615332 CATACTAGTTAGAAGAAGGAGGG + Intronic
1112179126 13:97059818-97059840 AATACAGGGTAGAATGAGGGAGG - Intergenic
1112657539 13:101467618-101467640 AAGGCTGGGTAGAAGAATGAGGG + Intronic
1113336729 13:109383690-109383712 AGGACTGGGTAGATGATGGTGGG + Intergenic
1113986082 13:114316919-114316941 AAAACTGGGGACAAGAAGATAGG + Intronic
1114133160 14:19816723-19816745 AATACTGTGTTGAATAAGGATGG + Intronic
1114281027 14:21192536-21192558 ATTCCTGGGTGGAAGAGGGTAGG + Intergenic
1114487560 14:23071997-23072019 ATTACTGGATAGAGGATGGTAGG - Intronic
1114865543 14:26590324-26590346 AAAACTGGGGGGACGAAGGTGGG - Intronic
1115039456 14:28905667-28905689 AATACTGGCTACCAGAAGCTAGG - Intergenic
1115379717 14:32722411-32722433 AATATTGGGTAGAAGAGGGCAGG + Intronic
1116298409 14:43142086-43142108 AGTACTGGGTAGAGAAGGGTGGG - Intergenic
1116345443 14:43786812-43786834 AATGCTGGGTAGAGAAAGGTGGG - Intergenic
1116602475 14:46944294-46944316 AATACAGCTTAGAAGAAAGTGGG - Intronic
1117450616 14:55846029-55846051 AATACTACGTAGAAAAGGGTGGG - Intergenic
1117893988 14:60459628-60459650 AATACTAAGTAGGAGAATGTAGG - Intronic
1120523217 14:85548731-85548753 AATACTGGGTAGAAGAAGTGTGG + Intronic
1120806077 14:88752622-88752644 AATACTGGGTAGAAGAAGGTGGG + Intronic
1121908383 14:97767710-97767732 AGTGCTGGGTAGAGGAAGGCGGG - Intergenic
1122643278 14:103175050-103175072 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1123098755 14:105779878-105779900 AATACCCGGTAGAGGATGGTGGG + Intergenic
1123765206 15:23471165-23471187 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1124405201 15:29385698-29385720 AATGCTGGGTAGAGAAGGGTGGG + Intronic
1124651979 15:31480732-31480754 AATACTGTTTAGAGGAAGGATGG + Exonic
1125450192 15:39799845-39799867 CAGACTGGGTAGAAGAGGGAGGG - Intronic
1126335500 15:47582671-47582693 AAGACTGGGGAGGAGACGGTGGG + Intronic
1127918235 15:63472797-63472819 AATAATGATAAGAAGAAGGTAGG + Intergenic
1131539057 15:93260856-93260878 AATAAAGGGGAGAAGAAGGGAGG - Intergenic
1132660016 16:1057195-1057217 AATTCTAGGTAGAAAAAGATGGG - Intergenic
1133180271 16:4049040-4049062 AATACAGGGAAGCAGAAGGCTGG + Intronic
1133439103 16:5805811-5805833 ATTACAGGGTAGCAGAAGGTGGG - Intergenic
1133834774 16:9358149-9358171 AAGAAATGGTAGAAGAAGGTGGG - Intergenic
1134478869 16:14600424-14600446 AATATAGGAGAGAAGAAGGTGGG - Intronic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1136043540 16:27598878-27598900 GATCCTGGGTAGAAACAGGTGGG + Intronic
1137680028 16:50333899-50333921 AACACTGGACAGAAAAAGGTAGG - Intronic
1138524453 16:57594114-57594136 AACATTGAGTAAAAGAAGGTGGG - Intergenic
1138836459 16:60441942-60441964 AGAACTGGATAGAAGAAGGAAGG - Intergenic
1139183099 16:64770640-64770662 GCTCCTGGGTAGAAGAGGGTGGG + Intergenic
1139342443 16:66277301-66277323 AATCCTGGGGACGAGAAGGTGGG + Intergenic
1139560931 16:67741643-67741665 AATACTTGGTAGAAGGATGAAGG - Intronic
1140805773 16:78530703-78530725 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1141173928 16:81707115-81707137 GATGCTGGCTAGAAGAAGGAGGG - Intronic
1141523326 16:84596001-84596023 AAAACTGCCCAGAAGAAGGTTGG + Intronic
1143128701 17:4662331-4662353 TATTCTGGCTAGAAGAAGGTTGG - Intergenic
1143742933 17:8966862-8966884 AAAAATGGGGATAAGAAGGTTGG + Intergenic
1144741000 17:17582169-17582191 ATTACTGGGTAGCAGAAAGCCGG - Intronic
1147230122 17:39011651-39011673 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1147781285 17:42944238-42944260 AATAATGGGAGGAAGAGGGTAGG - Intergenic
1151460815 17:74253054-74253076 AACAATGGGTAGAAGATGGCCGG - Intronic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1153459291 18:5316032-5316054 GTAACAGGGTAGAAGAAGGTGGG - Intergenic
1153751347 18:8234065-8234087 AATACTGATTAGAAAAAAGTTGG - Intronic
1155254190 18:23980308-23980330 AATCCTGGGAAGAAGGAGTTAGG - Intergenic
1155683617 18:28520413-28520435 AATACGGGGTAGAAGAGGGTGGG + Intergenic
1156311482 18:35926568-35926590 AATACTGTGTAGAAAAGGGCAGG + Intergenic
1156674799 18:39514668-39514690 ATTCCTGGGTAGAAAGAGGTAGG + Intergenic
1157014864 18:43699794-43699816 AATACTGGGGTGAAGACGATGGG - Intergenic
1157707464 18:49819415-49819437 CAAAGTGGGTGGAAGAAGGTGGG - Intronic
1158180825 18:54713259-54713281 AATGCTGGGTAGAGAAAGGCAGG - Intergenic
1159030584 18:63226395-63226417 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1159334710 18:67047346-67047368 AATAGTGGTTAGCAGAGGGTGGG - Intergenic
1159839946 18:73387407-73387429 AAGCCTGGGGAGAAGAAAGTAGG + Intergenic
1160127406 18:76189277-76189299 AATACTAGGTAGAAAAGGGTGGG + Intergenic
1161626811 19:5331786-5331808 AATACTGCGTAGAAGGAAGCCGG - Intronic
1164242237 19:23399721-23399743 AACACAGGGTAGAAGAGGGGAGG + Intergenic
1165058156 19:33191935-33191957 AGTACTGGGAAGGAGATGGTGGG - Intronic
1165930626 19:39356154-39356176 AATGCTGGGTAGAGGATGGATGG - Intronic
1167642268 19:50688287-50688309 AATACTGGGGACAAGGAGGGAGG - Intronic
1167941986 19:52955062-52955084 AATAATGGGTAGAAAAAGAATGG + Intronic
1168083565 19:54028355-54028377 AATACTGGGTATGAGCAGTTTGG - Intergenic
925656520 2:6155922-6155944 AATCCTGGGCAGAAGAAGGGGGG + Intergenic
926479482 2:13372888-13372910 AATAATACGTAGTAGAAGGTAGG + Intergenic
927262258 2:21103126-21103148 AATACTAGGTAGAAAAGGGTGGG - Intergenic
927583950 2:24282000-24282022 AGTACTGGGTAGAGAAAGGCGGG + Intronic
928494094 2:31813816-31813838 AATACTGGGTAGAAGAAGGTGGG - Intergenic
929726053 2:44428556-44428578 AATACTGAGTAGAAAAGGGTGGG - Intronic
930882664 2:56289670-56289692 AATAGTGGAAAGAAGATGGTAGG - Intronic
931458611 2:62431861-62431883 AATTCTGGGCAGAAGTGGGTGGG + Intergenic
931473059 2:62559224-62559246 AACACTTGGTAGAAGAATATTGG - Intergenic
933250696 2:80025302-80025324 AATGCTGGGTAGAAGAGGGTGGG - Intronic
933427109 2:82126905-82126927 AATACTGGGTAGAAGAGGGTGGG - Intergenic
933935942 2:87203979-87204001 TATACTGGGTAGATGAGGATGGG - Intergenic
934045695 2:88170924-88170946 AAGGCTGGGAACAAGAAGGTGGG - Intronic
935222446 2:101027212-101027234 GTTTCTGGGTAGAAGCAGGTAGG + Intronic
935882151 2:107575590-107575612 AGTGCTGGGTAGAGAAAGGTGGG + Intergenic
936046395 2:109191406-109191428 AATACTATTTAGAAGAAAGTGGG + Intronic
936647491 2:114388754-114388776 AATACTGGGAAGAAGACGGTAGG + Intergenic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
937891253 2:126940596-126940618 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
938787830 2:134648506-134648528 AATTCTGGGCAGAAGAGGGTGGG - Intronic
938856476 2:135317374-135317396 AATATTGGGAAGAAGTTGGTAGG + Intronic
939106829 2:137958586-137958608 AATGCTGTGTAGAAGAAAATGGG + Intergenic
941077248 2:161019973-161019995 AATTCTGGGTAAAACAAGTTTGG - Intergenic
941996469 2:171606037-171606059 AATACTGAGTAGAAGAGAGCAGG - Intergenic
942112682 2:172698202-172698224 AATATTTGGTAGAACAAAGTGGG - Intergenic
942772156 2:179534702-179534724 AATAAAGGGGAGAACAAGGTAGG - Intronic
943797850 2:192020135-192020157 AATACTAGGGAAAAGAGGGTAGG - Intronic
944599204 2:201286010-201286032 GATCCTGGTGAGAAGAAGGTGGG + Intronic
944866143 2:203864331-203864353 AATGCTGGGTAAAAGAATCTTGG - Intergenic
945492932 2:210476883-210476905 ATTACTGGGTAGCAGAAGTGAGG + Intronic
946216009 2:218184092-218184114 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
946453171 2:219798748-219798770 ACAACTGGGTAGGAGAAGATAGG - Intergenic
946779560 2:223179008-223179030 AATAGAGGGTAAAAGAAGGCTGG + Intronic
948703867 2:239777611-239777633 TGCACTGGGTGGAAGAAGGTGGG + Intronic
1168736119 20:138345-138367 AAATCTGGGCAGAAGCAGGTGGG - Intergenic
1169526694 20:6435873-6435895 AATACTTAGTAGAAGAAGAGAGG - Intergenic
1170119287 20:12894376-12894398 AATATTTGGTAGAAGAAGAAAGG - Intergenic
1171438313 20:25141041-25141063 AATATTGGGTGGAAGAAGCCAGG - Intergenic
1173872949 20:46352968-46352990 ACTACTGGGCTAAAGAAGGTAGG + Intronic
1174434992 20:50499930-50499952 AATTCTAGGGAGAAGAAGTTAGG - Intergenic
1174754806 20:53147442-53147464 TAGACTGGATTGAAGAAGGTAGG - Intronic
1175297617 20:57919897-57919919 ATTACTGGGGATAGGAAGGTGGG + Intergenic
1177124621 21:17181204-17181226 AATTCTGGGTAGAAGAGGGCAGG + Intergenic
1177703782 21:24674185-24674207 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178195885 21:30344676-30344698 AGTTCTGGGTAGAGAAAGGTGGG - Intergenic
1178447310 21:32658086-32658108 AATTCTGGGCAGAAGTGGGTGGG + Intronic
1182642578 22:31780356-31780378 AAGACAGGGAAGAAGCAGGTTGG + Intronic
1183808964 22:40237928-40237950 AAGACTGGGCAAAAGAAGGATGG - Intronic
1184613554 22:45622263-45622285 ATTAGTGGGTAGAAGCAGGTGGG + Intergenic
949218584 3:1601260-1601282 ATTCCTGGGTGGAAGGAGGTGGG - Intergenic
949684155 3:6549196-6549218 AATGCTGGGTAGAAAAGTGTGGG + Intergenic
949802058 3:7914950-7914972 AATACTGGGTAGAAGAGGGTGGG + Intergenic
951134083 3:19083447-19083469 AATACTGGGTAGAAAAGGGAAGG + Intergenic
951251096 3:20395215-20395237 AATTCTGGGAAGAAGAGGGCAGG + Intergenic
952109716 3:30108773-30108795 AATACTGGGTAGAAGAGGGCGGG + Intergenic
952561714 3:34603334-34603356 AATACTAGATAGAAAAGGGTGGG + Intergenic
952756760 3:36875752-36875774 AATTCTGGGGGGAAGTAGGTAGG - Intronic
954563594 3:51579401-51579423 AATTCTGGGCAGAAGAGGGCAGG - Intronic
955038662 3:55293402-55293424 AGTACTGGGTAGAAGTGGGTGGG + Intergenic
955950416 3:64237727-64237749 AATACTAGGCAGAAAAGGGTGGG - Intronic
956451276 3:69377658-69377680 AATAATGGGTTAATGAAGGTGGG + Intronic
956502009 3:69897041-69897063 AATGCAAGGTAGCAGAAGGTAGG + Intronic
957244652 3:77702065-77702087 AATACTAGGCAGAAAAGGGTGGG + Intergenic
957414184 3:79879017-79879039 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
958467387 3:94474022-94474044 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
959155647 3:102663715-102663737 AATACTAGGTAGAAAAGGGCAGG + Intergenic
959670469 3:108971575-108971597 TAGACTGGGGAGAGGAAGGTGGG + Intronic
960050774 3:113237408-113237430 GAGGCTGGGTAGAAGAAGGCAGG - Intronic
960690559 3:120342163-120342185 ATTCCTGGGCAGAAGAGGGTGGG + Intronic
962597424 3:136960801-136960823 AAAACAAGGTAGAAGAAGGGAGG + Intronic
963409669 3:144911514-144911536 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
963472283 3:145755250-145755272 CAGACTGGATAGAAAAAGGTTGG - Intergenic
963858378 3:150280383-150280405 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
964070036 3:152620237-152620259 GATCTAGGGTAGAAGAAGGTGGG + Intergenic
964105705 3:153037092-153037114 ATGGCTGGGGAGAAGAAGGTGGG + Intergenic
964202249 3:154130962-154130984 AATACAGGTTAGAAGAGGGAAGG - Intronic
965357107 3:167689586-167689608 AACACAGGGGAGAAGAAGGGAGG + Intronic
968676859 4:1886965-1886987 AATGTTGGGAAGAAGAAGGGAGG - Intronic
969822804 4:9733129-9733151 AATGCTGGGTAGAGAAGGGTGGG - Intergenic
970233505 4:13934487-13934509 AATGCTGGGTAGAGAAGGGTGGG - Intergenic
971873746 4:32276715-32276737 AATACTGGGTAGAAGAGATCAGG - Intergenic
972203889 4:36747898-36747920 ATTCCTGGGCAGAAGAGGGTGGG + Intergenic
972852691 4:43070666-43070688 AATACTGGGTAGAAGAGGGTGGG + Intergenic
973582657 4:52359474-52359496 AAGTTTGGGAAGAAGAAGGTGGG + Intergenic
974159320 4:58117564-58117586 AATCCTTTGTAGAATAAGGTGGG + Intergenic
974167086 4:58217285-58217307 CATACGGGGTAGAAAATGGTAGG + Intergenic
975606585 4:76161094-76161116 AATACTGGGTAGAATCAAATGGG - Exonic
975745546 4:77471372-77471394 GATCCTGGAGAGAAGAAGGTGGG + Intergenic
976031411 4:80758566-80758588 AATTCTGGGCAGAAGAGAGTGGG - Intronic
976042092 4:80898601-80898623 AATTCTGGGAAGAAGAGGGTGGG - Intronic
977045253 4:92061157-92061179 ACTGCTGGGTAGAGAAAGGTGGG - Intergenic
977721552 4:100245018-100245040 AATACAGGGTAGAAGAGGGTGGG - Intergenic
977827549 4:101551698-101551720 AATTCTGGGCAGAAGAGGGCAGG + Intronic
978211506 4:106143120-106143142 AATTTGGGGTAGAAGAATGTTGG - Intronic
978593833 4:110355775-110355797 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
979275675 4:118812299-118812321 AGTGCTGGGTAGAGAAAGGTGGG + Intronic
979596565 4:122541472-122541494 AATTCTGTGCAGAAGAGGGTGGG + Intergenic
980097364 4:128504988-128505010 AATAGTGGGTAGAAGAGGGTGGG - Intergenic
980495395 4:133584059-133584081 AATTCTGGGCAGAAGAGGATGGG + Intergenic
980731702 4:136832402-136832424 AGTGCTGGGTAGAAAAGGGTGGG - Intergenic
980737552 4:136911027-136911049 AATAGTGGTTAGCAGAGGGTGGG - Intergenic
981031136 4:140126992-140127014 AAGACTGGGTGGAGGGAGGTCGG - Intronic
981590825 4:146358633-146358655 AATACTAAGTAAAAGAAGGCAGG - Intronic
981597720 4:146446088-146446110 AATACTGGGTAGAAGAGGGTGGG - Intronic
981709274 4:147692867-147692889 AAGACAGTGTAGGAGAAGGTAGG + Intergenic
982560777 4:156926384-156926406 AGTACTGGGTAGATAAAGGCAGG + Intronic
982786678 4:159544392-159544414 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
982798536 4:159673797-159673819 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
983987233 4:174073868-174073890 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
984129602 4:175857009-175857031 AATACTGGGTAGAAGAGGGCAGG - Intronic
984873737 4:184349593-184349615 ACAACTGGGAATAAGAAGGTGGG - Intergenic
985271176 4:188196613-188196635 AGTGCTGGGTAGAGAAAGGTGGG + Intergenic
986163242 5:5250209-5250231 AATACTGGGTAGAAGATGGCAGG - Intronic
986231027 5:5864914-5864936 AGTACTGGGTAGAGAAGGGTGGG - Intergenic
986364822 5:7019664-7019686 AGTGCTGGGTAGAGAAAGGTGGG - Intergenic
986365391 5:7023414-7023436 AGTGCTGGGTAGAGAAAGGTGGG - Intergenic
986457197 5:7931435-7931457 AATACTGGATAGAAGAGGGTGGG + Intergenic
987251090 5:16102322-16102344 AATACTGGGTAGAAGAGGGTGGG + Intronic
987268222 5:16278357-16278379 AATACTGGGTAGAAGAGGGCCGG + Intergenic
987926762 5:24351431-24351453 AATACTGGGTAGAAAAGGGCGGG - Intergenic
988231413 5:28484152-28484174 AATTCTGGGCAGAAGAGAGTGGG - Intergenic
988635345 5:32977798-32977820 AATACTGGGTAGAAGAGGGCAGG + Intergenic
988941708 5:36153716-36153738 AGATCTGGGGAGAAGAAGGTTGG - Intronic
989456018 5:41645481-41645503 AATACTGGGTAGAACATGATGGG - Intergenic
990463083 5:56047620-56047642 AATACTGGGTAGAAGAGGGCAGG + Intergenic
990463718 5:56053060-56053082 AATACTAGGTAGAAAAGGATGGG + Intergenic
991208042 5:64072616-64072638 AATACTGAGTAGATGAAAATAGG + Intergenic
992437685 5:76771056-76771078 ACTACTGGGTGGGAGGAGGTAGG + Intergenic
993824016 5:92658799-92658821 AATACTTAGTAGAAGAAACTGGG - Intergenic
994188135 5:96838174-96838196 AATTCTGGGCAGAAGAGGGCAGG - Intronic
994913543 5:105944023-105944045 AATACTGGGAAGAAGAGGACAGG - Intergenic
995322288 5:110849723-110849745 AATACTGGGTAGAATGAGTATGG + Intergenic
995656736 5:114434550-114434572 GATACTGGGTAAAAGGAGCTGGG + Intronic
996101565 5:119450323-119450345 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
996242010 5:121215596-121215618 AATACTGGGTAGAAGAGGGCAGG + Intergenic
996502207 5:124229958-124229980 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
996576688 5:124983678-124983700 AATACTAGGTAGAAAAGGGTGGG + Intergenic
996650808 5:125873713-125873735 AATTCTGGGCAGAAGAAGGTGGG - Intergenic
997105633 5:131016132-131016154 AATACTGTGTTGAAGAAGAGTGG + Intergenic
997318201 5:132955361-132955383 AATACTGGCTAGAAGTGGGTGGG - Intronic
998064768 5:139148982-139149004 AACACTGGGTAGAAGAAGCTTGG + Intronic
998644040 5:144042525-144042547 AATTCTGGGCAGAAGAGGGAGGG - Intergenic
998747059 5:145272979-145273001 AATACAGAGTAGCAGCAGGTGGG + Intergenic
998813235 5:145986980-145987002 AATATTGGCTTGAAGAAGGAAGG + Intronic
1000234504 5:159344889-159344911 AATACTGGGTAGAAGAGGGCAGG - Intergenic
1000866329 5:166519012-166519034 AATTCTGGGAAGAAGAAGGAGGG - Intergenic
1001569381 5:172720089-172720111 ACTACTGGAGTGAAGAAGGTTGG - Intergenic
1004977564 6:20984935-20984957 AATTCTGGGTAGAAAAGGGCAGG - Intronic
1005029229 6:21493681-21493703 AATGCTGGGTAGAGAAAGGCGGG + Intergenic
1005152531 6:22768656-22768678 AACAGTGGTTAGAAGAAGGAAGG - Intergenic
1005453573 6:25997800-25997822 AGTTCTGGTTAGTAGAAGGTGGG + Intergenic
1005508564 6:26491825-26491847 AATTCAGGTTAGAACAAGGTAGG + Intergenic
1006149414 6:31978574-31978596 AATTCTGGGTAGGGTAAGGTGGG - Intronic
1007027924 6:38596921-38596943 AATAATGGCTAGACCAAGGTCGG + Intronic
1007931985 6:45700019-45700041 AATACTGGGCAGAAGAGGGCAGG + Intergenic
1008215535 6:48783248-48783270 AATTCTAGGCAGAAAAAGGTGGG - Intergenic
1008236385 6:49056931-49056953 AAGACTGGGAACAAGAAGGGGGG + Intergenic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1008335062 6:50293407-50293429 AATACTCTCTAGAAGAAGGCGGG + Intergenic
1008622707 6:53287393-53287415 AACAGTGGGATGAAGAAGGTGGG + Intronic
1008652591 6:53578077-53578099 ACTACTGGGGAGAATAGGGTTGG + Intronic
1009524723 6:64729203-64729225 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1010327580 6:74582380-74582402 AATACTGGGTAGAAGAGCATGGG - Intergenic
1010621843 6:78086021-78086043 AAAACTGGGTAGAAAAGGGCGGG - Intergenic
1011261764 6:85477020-85477042 AATACTAGGTAGAAAAGGGTGGG - Intronic
1011899590 6:92275431-92275453 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1012025642 6:93986487-93986509 AGTTCTGGGTAGAAGAAGTAGGG - Intergenic
1012263302 6:97112152-97112174 AATTCTGGGCAGAAGAAGATGGG - Intronic
1012743746 6:103055363-103055385 AATACTGGGTAGAAAAGTGTTGG - Intergenic
1013492396 6:110660931-110660953 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1013561500 6:111309679-111309701 AGTGCTGGGTAGAGAAAGGTGGG - Intronic
1014812471 6:125902187-125902209 AATACTAGGTAAAAAAGGGTGGG - Intronic
1014943415 6:127469973-127469995 AATACTGGGGAGAGGAAAGTAGG - Intronic
1016549009 6:145255870-145255892 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1016714726 6:147211696-147211718 AATACTTGGTAGGCCAAGGTAGG - Intronic
1018155003 6:160977559-160977581 AAGATAGAGTAGAAGAAGGTGGG + Intergenic
1018629617 6:165810677-165810699 CATCCTGGGGAGAGGAAGGTAGG - Intronic
1018842964 6:167531814-167531836 AGTGCTGGGTAGAGAAAGGTGGG + Intergenic
1019897959 7:3997814-3997836 ACTCCTGGGCAGAAGAAGGTGGG - Intronic
1020284169 7:6667496-6667518 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
1020553241 7:9634943-9634965 TACTCTGGGCAGAAGAAGGTGGG - Intergenic
1020739133 7:11990702-11990724 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1021167679 7:17360468-17360490 AATACTAAGTAGAAAAGGGTGGG - Intergenic
1023006506 7:35875548-35875570 CATACTTGGTAGAGGGAGGTAGG - Intronic
1024062945 7:45712617-45712639 AACTCTGGGTATTAGAAGGTGGG + Intronic
1024067709 7:45755415-45755437 CATACTTGGTAGAGGGAGGTAGG + Intergenic
1024265057 7:47600103-47600125 AGAGCTGGGTAGAAGAAGGCGGG + Intergenic
1024440189 7:49408036-49408058 AGTGCTGGGTAGAAAAAGGTGGG + Intergenic
1024687152 7:51758451-51758473 AATAGTGAGAAGAAGAGGGTGGG + Intergenic
1025055489 7:55761438-55761460 ACTACTTGGTAGAATGAGGTGGG + Intergenic
1025910468 7:65824712-65824734 ACTACTTGGTAGAATGAGGTGGG - Intergenic
1026044650 7:66898652-66898674 ACTACTTGGTAGGATAAGGTGGG - Intergenic
1026280963 7:68921498-68921520 AATTCTAGGCAGAAGAGGGTGGG + Intergenic
1026919449 7:74144463-74144485 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1027347760 7:77279165-77279187 AATCCTGGGGATAAGAAGATAGG + Intronic
1028244724 7:88463019-88463041 AATACTGGCAAGCAGAAGTTGGG + Intergenic
1028501192 7:91520648-91520670 AATTCTGGGAAGAAGAGGGTGGG + Intergenic
1028616255 7:92770845-92770867 AACACTGGGTAGAGGAAAGTGGG + Intronic
1029497472 7:100903902-100903924 AATACTGGGTCGAGGAAGGCAGG - Intergenic
1030003718 7:105094291-105094313 AATACTAGGTAGAATAAAGATGG + Intronic
1030281063 7:107775838-107775860 AAAACTCGGTAGAAAAATGTCGG + Intronic
1030546933 7:110907615-110907637 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1031075734 7:117210466-117210488 AATGCTGGGTAGATGAATGCGGG + Intronic
1031525127 7:122816198-122816220 AATAATGGTTAGAAGAGGCTGGG - Intronic
1031963535 7:128010803-128010825 ACTACTGGGTAAAGGAAGGCTGG - Intronic
1032625799 7:133590390-133590412 AATACTGGGTAGAAAACGGCAGG + Intronic
1032721359 7:134553051-134553073 AATGCTGGGAAGAAAAAGCTGGG - Intronic
1033857231 7:145578182-145578204 AATACTGGGTAGAAAAGGGCAGG - Intergenic
1034388124 7:150757879-150757901 AAGAGTGAGTAAAAGAAGGTGGG + Intergenic
1036290053 8:7479735-7479757 AATACCGGAAAGAACAAGGTTGG + Intergenic
1036331423 8:7831788-7831810 AATACCGGAAAGAACAAGGTTGG - Intergenic
1037427447 8:18771292-18771314 AATTCTGGGCAGAAGAGGATGGG - Intronic
1037553534 8:19998777-19998799 CATACTGGGTAGAATCTGGTTGG - Intergenic
1037763343 8:21756629-21756651 CCCACTGGGAAGAAGAAGGTGGG + Intronic
1038369114 8:26970042-26970064 AATTATGGGCAGAAGAGGGTGGG - Intergenic
1038491006 8:27971200-27971222 AATACAGGGAAGAATGAGGTTGG + Intronic
1039039633 8:33395143-33395165 AATACTGGGTAGAAGAGGGTGGG + Intronic
1039252560 8:35682777-35682799 AAAACTGGGAAGAAGAAAATAGG + Intronic
1039290500 8:36089218-36089240 AATACTGGGTAGAAGAGAGTGGG - Intergenic
1039661305 8:39470506-39470528 AATCCTAGGCAGAAGAGGGTGGG + Intergenic
1040548354 8:48419697-48419719 AATACTGGGAAGGAAAAGGAGGG - Intergenic
1042004359 8:64165247-64165269 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1042819766 8:72917070-72917092 AATTCTGGGTGGAAGAGGGTGGG - Intronic
1042854200 8:73248969-73248991 AATACTGTGTTGAATAAGGGTGG + Intronic
1043220399 8:77655485-77655507 AATCCTGGGTAGAAGTGGGCAGG + Intergenic
1044286876 8:90420098-90420120 AATTCTGGGCAGAAGAGTGTGGG - Intergenic
1044334008 8:90954702-90954724 AATATTGGGTATAAGCAAGTAGG - Intronic
1044766698 8:95583595-95583617 AATATTGGTTGGCAGAAGGTAGG - Intergenic
1044900311 8:96937019-96937041 AATACTGGAAAGAAAAAGGGAGG - Intronic
1045074250 8:98545169-98545191 GACACTGGGTAAAAGCAGGTTGG - Intronic
1046185634 8:110712576-110712598 AATAATGGGTAATAGAATGTTGG - Intergenic
1046277509 8:111982646-111982668 AGTGCTGGGTAGAAGAAGGCGGG - Intergenic
1046672550 8:117072608-117072630 AATACTGTGGAGAAAAAAGTAGG - Intronic
1047113545 8:121817145-121817167 AATACTAGGTAGAAAAAAGTGGG + Intergenic
1048525062 8:135194924-135194946 AAAACCAGGAAGAAGAAGGTAGG - Intergenic
1048800351 8:138188928-138188950 AATTCTGGGCAGAAGAGGGAAGG + Intronic
1050043549 9:1520719-1520741 AATACTGGCTAGATAAAGGCAGG + Intergenic
1050119653 9:2295403-2295425 AATTGTGGGAAGAAGAAGATAGG + Intergenic
1050990848 9:12149700-12149722 AATTCTGGGCAGAAGAGAGTAGG - Intergenic
1052338264 9:27340874-27340896 AATGCTGGGTATGAGAAGGAGGG - Intronic
1052459685 9:28746983-28747005 AATACTGGGTAGAAAGAAGAGGG + Intergenic
1053545418 9:39018138-39018160 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1053596933 9:39572459-39572481 AAAACTAGGTAGTAGAAAGTAGG - Intergenic
1053809748 9:41839836-41839858 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1054620845 9:67347592-67347614 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1054715471 9:68553440-68553462 AAAAATGGGTAGAAGAAGGAAGG + Intergenic
1056004398 9:82252488-82252510 GAAACTGGGTGGAAGATGGTAGG - Intergenic
1056144004 9:83711250-83711272 AATAATGGGTACAAGGAGGTGGG - Intergenic
1056192064 9:84194533-84194555 AGTCCTGGGTGGAAGAAGGCAGG - Intergenic
1056279554 9:85027998-85028020 AATACTGAGAACAAGAATGTGGG - Intergenic
1056327285 9:85490562-85490584 AATACTGGGTAGAGAAGGGTGGG + Intergenic
1056427067 9:86488212-86488234 AACTCTGGGCAGAAGAGGGTGGG + Intergenic
1058312004 9:103515184-103515206 AGTGCTGGGTAGAGAAAGGTGGG - Intergenic
1058981362 9:110173651-110173673 AATCCTGGGGAGAAAAAGGCTGG - Intergenic
1059745488 9:117196356-117196378 AATCCTGAGTAGAAGATGGATGG - Intronic
1185683297 X:1906671-1906693 AATACTGGGTAGAAAAGCGTGGG - Intergenic
1185945155 X:4367587-4367609 AATACTAGGTAGAAAAGGGTGGG + Intergenic
1186033268 X:5392613-5392635 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1186128674 X:6443089-6443111 AATTCTGGGCAGAAGAGGGCGGG - Intergenic
1187867187 X:23734065-23734087 ATTACTGCGTATAAGAAGATAGG - Intronic
1187940049 X:24372589-24372611 AATCCTGCTTAGAAGAAGGCAGG - Intergenic
1188116743 X:26254124-26254146 AATTCTGGGCAGAAGAGTGTAGG + Intergenic
1188317423 X:28691665-28691687 AAGACAGGATAGAAGAAGGGAGG - Intronic
1188438052 X:30185379-30185401 AATACTGGGTAGAAAAGGGCAGG + Intergenic
1188554841 X:31399566-31399588 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1189381325 X:40504601-40504623 AATAATGAGGAAAAGAAGGTAGG + Intergenic
1189405303 X:40716984-40717006 AATGCTGGTTAGGAGAAGCTGGG + Intronic
1189675086 X:43453179-43453201 AATTCTGGGCAGAAGAGGATGGG - Intergenic
1189863352 X:45296472-45296494 ATTACTGGGTTAAAGAATGTAGG + Intergenic
1190942584 X:55056624-55056646 AATACTGGACTGAAGAAGATGGG + Intergenic
1191767166 X:64710347-64710369 AATACTAGGTAGAAAAGGGCAGG - Intergenic
1191921147 X:66258365-66258387 AAAAATGGGTAAAAGAAGGCAGG + Intronic
1193183690 X:78487254-78487276 AACGCTGGGTAGAGGAGGGTTGG - Intergenic
1193228684 X:79016342-79016364 AATACTGAGTGGAAAAAAGTTGG + Intergenic
1193846607 X:86479380-86479402 AGTGCTGGGTAGAAAACGGTGGG - Intronic
1193998546 X:88397906-88397928 AATACTATGTAGAAGAAGGGAGG - Intergenic
1194487683 X:94505732-94505754 GATATTGGGAAGTAGAAGGTGGG + Intergenic
1195128403 X:101831229-101831251 ACTACAGGGAAGAACAAGGTTGG + Intergenic
1195177796 X:102327603-102327625 ACTACAGGGAAGAACAAGGTTGG - Intergenic
1195181068 X:102359490-102359512 ACTACAGGGAAGAACAAGGTTGG + Intergenic
1195647039 X:107244318-107244340 AATACAGTATAGAAGAAGGAGGG - Intergenic
1195721346 X:107871994-107872016 AATTCTGGGCAGAAGAGGATAGG - Intronic
1195722510 X:107879678-107879700 AATTCTGGGCAGAAGAGAGTGGG - Intronic
1196072238 X:111538987-111539009 AATGCTGGGTAGAGAAAGGCTGG + Intergenic
1198270933 X:135055583-135055605 AGTGCTGGGTAGAGAAAGGTGGG + Intergenic
1199336996 X:146630165-146630187 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1199591349 X:149470898-149470920 AATACTCGGCAGATGAAGCTCGG - Intergenic
1201340404 Y:12926673-12926695 AGTGCTGGGTAGAGAAAGGTGGG - Intergenic
1201547674 Y:15183933-15183955 AATACTGGGTAGAAAAGGGTGGG + Intergenic
1201639109 Y:16159966-16159988 AATTCTGGGTAGAAGAGGGTGGG + Intergenic
1201663704 Y:16425361-16425383 AATTCTGGGTAGAAGAGGGTGGG - Intergenic
1201977221 Y:19865010-19865032 AATACTTAATAGCAGAAGGTTGG - Intergenic