ID: 1120806446

View in Genome Browser
Species Human (GRCh38)
Location 14:88756121-88756143
Sequence GGGGTGGTATTCATCAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120806446 Original CRISPR GGGGTGGTATTCATCAAGTC AGG Intronic
906075971 1:43052424-43052446 GGGGTGGTATTGCTGAAGCCAGG + Intergenic
913327710 1:117641504-117641526 GGCGTGGAATTCTTAAAGTCTGG - Intergenic
923569117 1:235098636-235098658 GGGGTGCTATTCCCAAAGTCAGG + Intergenic
924494243 1:244571303-244571325 AGAGGGGAATTCATCAAGTCAGG - Intronic
1069924107 10:71836437-71836459 GTGGTGGGAGTCATCAGGTCTGG - Intronic
1079356024 11:19730810-19730832 GGGGTGTTATTTATCCAATCAGG - Intronic
1092106204 12:5923362-5923384 GGGGTGGCATTGAGCAAGTCAGG + Intronic
1094312710 12:29102924-29102946 GCGGTTTTATTCATCAACTCTGG + Intergenic
1097009852 12:55945102-55945124 GGGGTGGCATTTATTAAGACAGG + Intronic
1102919836 12:116783577-116783599 GGGGTGTTATTGCTCAAGTGAGG - Intronic
1111400517 13:87728317-87728339 GAGGTAGCATTCATTAAGTCAGG + Intergenic
1120806446 14:88756121-88756143 GGGGTGGTATTCATCAAGTCAGG + Intronic
1122910449 14:104825373-104825395 TGGGTGGGATTCATGAAGGCAGG + Intergenic
1124642930 15:31408566-31408588 GGGGTTCTATTAATCTAGTCAGG - Intronic
1128262777 15:66243996-66244018 TGGGAGGTAGGCATCAAGTCGGG + Intronic
1130905716 15:88239716-88239738 GGGCTGGTATTCTTCAAGAATGG + Intronic
1132607252 16:798753-798775 GGGTTGTTCTTCATCAGGTCGGG + Exonic
1147048399 17:37771971-37771993 GGGGTGGGATTCATAATGGCAGG - Intergenic
1157803679 18:50642310-50642332 GGGGTGGAATTCTTCAGCTCTGG - Intronic
1158768993 18:60491798-60491820 GTAGTGGTATTCATCAAGTGTGG - Intergenic
1164013234 19:21228071-21228093 GGGGGGGTTCTCACCAAGTCAGG - Intronic
1166658400 19:44628850-44628872 GGGGTGGCATTTAACGAGTCAGG + Intronic
925694006 2:6555087-6555109 GGTGTGGTATTCATTCAGCCTGG - Intergenic
934077026 2:88437195-88437217 GTGGTGGTGTTCACCAGGTCCGG - Intergenic
934841324 2:97625968-97625990 AGGGGGGTATCCATGAAGTCAGG + Intergenic
936563113 2:113559304-113559326 GTGGTGCTATTAATCAAGTCAGG - Intergenic
940612036 2:156005136-156005158 GGGGTGCTATTAATTAAGACAGG - Intergenic
943767963 2:191682626-191682648 TGGGTTGTATTCATAAAGTATGG + Intronic
944993547 2:205267477-205267499 GGGGCTGTATTCATCAAGGAAGG + Intronic
1170661556 20:18346028-18346050 GGGGTGGTATTGATTGAGCCTGG + Intergenic
1173019961 20:39258827-39258849 GGGTTGGTATTCTTCATCTCTGG + Intergenic
1175253320 20:57622768-57622790 GAGCTGTGATTCATCAAGTCTGG - Intergenic
1176024033 20:62976849-62976871 GGGTTGGTCTTAATCCAGTCTGG - Intergenic
1181008221 22:20024662-20024684 GGGAGGGTAGCCATCAAGTCGGG - Intronic
1203296049 22_KI270736v1_random:44032-44054 GGATTAGGATTCATCAAGTCTGG - Intergenic
954380189 3:50215211-50215233 GGGGTGGTGTTCATCACCCCTGG + Intronic
967322762 3:188210830-188210852 GGGGTGGTCTTCATTCTGTCAGG - Intronic
971107371 4:23541834-23541856 GGGGTGGGATTTCCCAAGTCAGG + Intergenic
986233750 5:5888592-5888614 GGGTTGCTATGCATCAACTCAGG - Intergenic
986262158 5:6156845-6156867 TGGGTGGCATTCATGCAGTCAGG - Intergenic
992396308 5:76372423-76372445 GGGGTGGAAGTTATCAGGTCAGG - Intergenic
992410977 5:76504963-76504985 GGGGTGGATTTCAGCAAGTGGGG - Intronic
995995973 5:118299899-118299921 GTGGTGGTAATCATCAAAACAGG - Intergenic
1016563466 6:145424135-145424157 TGGTTGGTATTCACCAAGTGTGG - Intergenic
1032386745 7:131530441-131530463 TGGGTGTTATTAATCAGGTCAGG + Intronic
1035154430 7:156900654-156900676 GGGCTGGAAGTCAGCAAGTCTGG - Intergenic
1043382614 8:79719800-79719822 GGGCTGGTGTGCATGAAGTCTGG - Intergenic
1049889618 9:56383-56405 GTGGTGCTATTAATCAAGTCAGG + Intergenic
1051133497 9:13890900-13890922 GTGGAGCTATTCATGAAGTCAGG + Intergenic
1051684514 9:19643399-19643421 GTGGTGGTACCCATTAAGTCTGG - Intronic
1053731101 9:41057658-41057680 GTGGTGCTATTAATCAAGTCAGG + Intergenic
1054697411 9:68374431-68374453 GTGGTGCTATTAATCAAGTCAGG - Intronic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1058830660 9:108813392-108813414 GGGGAGGTATTCACCAAGTGTGG + Intergenic
1200818825 Y:7561414-7561436 GGTGTGGTATACATCAAGCAGGG - Intergenic