ID: 1120811093

View in Genome Browser
Species Human (GRCh38)
Location 14:88804103-88804125
Sequence AGGTAGTAGCTAAGTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120811093_1120811098 22 Left 1120811093 14:88804103-88804125 CCTTCTTTACTTAGCTACTACCT No data
Right 1120811098 14:88804148-88804170 AGAGCCTGAGGCAATGATTAAGG No data
1120811093_1120811097 10 Left 1120811093 14:88804103-88804125 CCTTCTTTACTTAGCTACTACCT No data
Right 1120811097 14:88804136-88804158 TCTCAAGAAAACAGAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120811093 Original CRISPR AGGTAGTAGCTAAGTAAAGA AGG (reversed) Intergenic
No off target data available for this crispr