ID: 1120811389

View in Genome Browser
Species Human (GRCh38)
Location 14:88807417-88807439
Sequence TCAAGGAACTTACAGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120811389_1120811400 18 Left 1120811389 14:88807417-88807439 CCCACCAGCTGTAAGTTCCTTGA No data
Right 1120811400 14:88807458-88807480 TTAGGGGCAGAGCAGGGAAATGG No data
1120811389_1120811395 0 Left 1120811389 14:88807417-88807439 CCCACCAGCTGTAAGTTCCTTGA No data
Right 1120811395 14:88807440-88807462 GGGCTTTCATCAGAAAGATTAGG No data
1120811389_1120811397 2 Left 1120811389 14:88807417-88807439 CCCACCAGCTGTAAGTTCCTTGA No data
Right 1120811397 14:88807442-88807464 GCTTTCATCAGAAAGATTAGGGG No data
1120811389_1120811396 1 Left 1120811389 14:88807417-88807439 CCCACCAGCTGTAAGTTCCTTGA No data
Right 1120811396 14:88807441-88807463 GGCTTTCATCAGAAAGATTAGGG No data
1120811389_1120811398 11 Left 1120811389 14:88807417-88807439 CCCACCAGCTGTAAGTTCCTTGA No data
Right 1120811398 14:88807451-88807473 AGAAAGATTAGGGGCAGAGCAGG No data
1120811389_1120811399 12 Left 1120811389 14:88807417-88807439 CCCACCAGCTGTAAGTTCCTTGA No data
Right 1120811399 14:88807452-88807474 GAAAGATTAGGGGCAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120811389 Original CRISPR TCAAGGAACTTACAGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr