ID: 1120813345

View in Genome Browser
Species Human (GRCh38)
Location 14:88826897-88826919
Sequence TGCATCCTGAATCTCCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120813345_1120813349 10 Left 1120813345 14:88826897-88826919 CCTTCTTGGAGATTCAGGATGCA 0: 1
1: 0
2: 6
3: 45
4: 255
Right 1120813349 14:88826930-88826952 TCTGAGTAGTTTTGAAGAAAAGG 0: 1
1: 0
2: 1
3: 34
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120813345 Original CRISPR TGCATCCTGAATCTCCAAGA AGG (reversed) Intronic
902261191 1:15226150-15226172 TGCATCATAAATCTCAAAGGAGG + Intergenic
902313439 1:15599595-15599617 TTCATCCCGAAACTCCAAAAAGG - Intergenic
902735045 1:18394955-18394977 TGCCTCCTGAGCCTCCAAGAGGG + Intergenic
903385346 1:22922617-22922639 TGCAATGTGAATCTCTAAGAAGG + Intergenic
904422693 1:30404403-30404425 TGCCTGGTGAATCTGCAAGAGGG + Intergenic
904441813 1:30536633-30536655 CCCATCCTGAAGCTCAAAGAAGG + Intergenic
906564217 1:46786403-46786425 TGAATCCTGGGTCTCCAAAAAGG + Intronic
907271814 1:53295680-53295702 GGCATCATGCATCTCCAAGGGGG - Intronic
907771534 1:57469842-57469864 TATATTGTGAATCTCCAAGAAGG - Intronic
907824945 1:58006707-58006729 TGAATTCTGAACCTGCAAGAAGG + Intronic
907930018 1:58990556-58990578 TGGATCCTGAGGATCCAAGATGG - Intergenic
909209760 1:72808397-72808419 TGCAGCTTGAAGATCCAAGAGGG - Intergenic
910002614 1:82357650-82357672 TGCATCATCCATCACCAAGAAGG + Intergenic
911654655 1:100429808-100429830 TGCTTTGTAAATCTCCAAGATGG - Intronic
911668104 1:100577344-100577366 TGCATTTTGAATCTTCAAAAAGG + Intergenic
916623599 1:166528630-166528652 TGAATCCTGGATCTCCAAAAAGG - Intergenic
919327128 1:196122559-196122581 TGTATCCTGTGTCTCCATGAGGG + Intergenic
919668152 1:200312514-200312536 TCCATCCTGCGTCTCAAAGATGG + Intergenic
920506134 1:206516862-206516884 TGCACCCAAGATCTCCAAGAGGG - Intronic
920845146 1:209587507-209587529 TGGATTGTGAATCTCCAAGAAGG + Intronic
922245451 1:223792004-223792026 TCCATTCTATATCTCCAAGAGGG - Intronic
923692247 1:236205890-236205912 TGTGCTCTGAATCTCCAAGAGGG + Intronic
1063984420 10:11486726-11486748 TGCCTCATGAATATCTAAGAAGG - Intronic
1065397711 10:25257946-25257968 TGCATCCTGACTCTTCGAGATGG + Intronic
1067420149 10:46138107-46138129 TGAATCCTGAATCTCCCAAAAGG + Intergenic
1067424895 10:46200502-46200524 TGCCTCCCAAAGCTCCAAGAAGG + Intergenic
1067425870 10:46211413-46211435 TGAATCCTGAATCTCCCAAAAGG - Intergenic
1067505495 10:46844595-46844617 TGAATCCTGAATCTCCCAAAAGG + Intergenic
1069039652 10:63682413-63682435 TGCTTCCTGAATCCCTTAGAAGG + Intergenic
1070861381 10:79666714-79666736 TGCCTCCCAAAGCTCCAAGAAGG + Intergenic
1071610845 10:87030032-87030054 TGAATCCTGGATCTCCAAAAAGG + Intergenic
1072836058 10:98713608-98713630 TACATTCGGAATCTCCAAGAAGG - Intronic
1074025786 10:109632521-109632543 TGAATCCTGAATCTCCAAAAAGG - Intergenic
1074649568 10:115505234-115505256 TGAATCCTGGGTCTCCAAAAAGG + Intronic
1074723499 10:116284408-116284430 TGTGCCCTAAATCTCCAAGACGG - Intergenic
1076134378 10:128035672-128035694 TGCCCCCTGCAGCTCCAAGAGGG - Intronic
1076294539 10:129374356-129374378 TGCATCTTGAGCCTCCAACATGG - Intergenic
1081776982 11:45682314-45682336 CGCATGGCGAATCTCCAAGAGGG + Intergenic
1081829040 11:46090515-46090537 TGCATTGTGAATCTCCAAGAGGG - Intronic
1082109798 11:48261898-48261920 TGCACACAGAATCTCAAAGAAGG - Intergenic
1082949602 11:58798314-58798336 TGAATCCTGGATCTCCAAAATGG + Intergenic
1082989925 11:59198420-59198442 TGGATTCTGCATCTCCGAGAAGG + Intronic
1085394022 11:76197513-76197535 TGCATCCTGACTCTCCAAGCAGG - Intronic
1086147199 11:83565227-83565249 TGCAATCTGAAGCTCCCAGAAGG + Intronic
1086996122 11:93358454-93358476 TGTACCCTTAATCTCCAGGAGGG - Intronic
1088401812 11:109429695-109429717 AAGTTCCTGAATCTCCAAGAAGG - Intergenic
1089302099 11:117504889-117504911 CCCAGCCAGAATCTCCAAGAAGG - Intronic
1089967599 11:122666167-122666189 TGCTACCTGAATCACCAAGAAGG - Intronic
1090222956 11:125046484-125046506 TGCATCCTCAATTTCAAACAGGG + Intergenic
1090309638 11:125723785-125723807 TGTATTCTGAATGACCAAGAGGG - Intergenic
1091884977 12:4010226-4010248 TGCATTCTGAATCTCCAGTGGGG + Intergenic
1096452687 12:51757199-51757221 TGCATCCTGCATCTCCAGTTAGG - Intronic
1097712404 12:62931448-62931470 TGCATCCTGAATGATCAAAATGG - Intronic
1098137009 12:67413499-67413521 TGCATCTTCAGTTTCCAAGAGGG + Intergenic
1100294910 12:93252044-93252066 TGGATCCTGGATCCCCAAAAAGG + Intergenic
1100896065 12:99183762-99183784 TTCCTCATGAATCTCCAATAAGG + Intronic
1102078345 12:110077790-110077812 TCCATCATGGATCTCCCAGAAGG + Intergenic
1102192719 12:111001184-111001206 TGGGTCATGAATCTCTAAGAGGG - Intergenic
1104030460 12:125061930-125061952 TGAATCCTGGGTCTCCAAAAAGG + Intergenic
1104608682 12:130209399-130209421 AGCATTGTAAATCTCCAAGAGGG - Intergenic
1105017793 12:132796653-132796675 TGCCTCCTGAATCTGCATGAAGG + Exonic
1105357886 13:19676343-19676365 TGCATTCTGAAGCTCCCAGATGG + Intronic
1107084030 13:36406060-36406082 TGCTTCCTGAATCTCAAGAATGG + Intergenic
1107555909 13:41516550-41516572 TGCTTTCTAACTCTCCAAGAAGG - Intergenic
1111649067 13:91066845-91066867 TACATAATGAAACTCCAAGAAGG - Intergenic
1113373054 13:109740095-109740117 TGAATCCTGAAACTGAAAGAGGG - Intergenic
1113942618 13:114026307-114026329 TGCCTCCTGCACCTCCAACAGGG + Intronic
1114904442 14:27108664-27108686 TGCATTGTGAATCACCAAGACGG + Intergenic
1115087280 14:29532766-29532788 TGCATTGTGGAACTCCAAGAAGG + Intergenic
1115797064 14:36950002-36950024 TACAGTCTGACTCTCCAAGAAGG + Intronic
1116378205 14:44230736-44230758 TGCATTATGAATATCCAAAAAGG + Intergenic
1117187807 14:53259628-53259650 TGAATCCTGGGTCTCCAAAAAGG + Intergenic
1118631838 14:67712272-67712294 TGAATCCTGGGTCTCCAAAAAGG + Intronic
1120813345 14:88826897-88826919 TGCATCCTGAATCTCCAAGAAGG - Intronic
1121699069 14:95938344-95938366 AGCTTGCAGAATCTCCAAGAGGG + Intergenic
1122434277 14:101682953-101682975 TGAATCCTGGGTCTCCAAAAAGG + Intergenic
1122550361 14:102545857-102545879 TTCATCCTGCAACTCCCAGACGG + Intergenic
1125722467 15:41851845-41851867 TGCATCCTGAAAATGCAAGATGG + Exonic
1127326827 15:57903878-57903900 TGCCTCCTGCTTCTCCAAGCTGG - Intergenic
1128779343 15:70348586-70348608 TGCACCTTGAATCTGCAAGAGGG + Intergenic
1128921382 15:71613241-71613263 AGCCTTATGAATCTCCAAGAGGG - Intronic
1129570969 15:76683104-76683126 TGCCTCCTGAATCTCCACAATGG - Intronic
1130723567 15:86414643-86414665 TGCATGGAGACTCTCCAAGATGG + Intronic
1130874773 15:88004220-88004242 GGCATCCCTGATCTCCAAGAGGG + Intronic
1130975261 15:88769011-88769033 TGCACCGTGAATCTCCGAGAGGG + Intergenic
1132072813 15:98794492-98794514 AGCATCATGATTCTCCAGGATGG + Intronic
1133946779 16:10355520-10355542 TGCCTCCTAAATCTCCCCGAAGG + Intronic
1134384063 16:13755565-13755587 TCCCTCTTGAATCTCCAAGAGGG - Intergenic
1136162203 16:28427706-28427728 TGCAACCTCCATCTCCTAGAAGG + Intergenic
1136200762 16:28687283-28687305 TGCAACCTCCATCTCCTAGAAGG - Intergenic
1136217104 16:28801470-28801492 TGCAACCTCCATCTCCTAGAAGG - Intergenic
1137250730 16:46738646-46738668 GGCATCCTGTTTCTCTAAGAAGG + Intronic
1137452790 16:48592329-48592351 TGCATCCTGGATTTTCAAAAGGG - Intronic
1137546211 16:49405392-49405414 TGCCTCCAGAACCTCCAAGGAGG + Intergenic
1139417478 16:66825491-66825513 TGTATTATGAATTTCCAAGAGGG - Intronic
1140458745 16:75121045-75121067 TGAATCCTGGGTCTCCAAGAAGG - Intergenic
1141289002 16:82700219-82700241 TGCATACTGAATTTCCAAGAAGG + Intronic
1142321096 16:89383516-89383538 TGCCTCCTGTGTCTGCAAGAAGG + Intronic
1143486582 17:7258615-7258637 TTCAGCCTGGATCTCCAAGAGGG + Exonic
1144041629 17:11416345-11416367 TGCATGGTGGATCTCCAAGACGG + Intronic
1145377120 17:22361011-22361033 TGCATCCTTCATCTACAAAATGG + Intergenic
1145408179 17:22628887-22628909 TGCCTCCCAAAGCTCCAAGAAGG - Intergenic
1146472681 17:33137320-33137342 TGCATTGTGAATCTCCAAGTGGG + Intronic
1146647529 17:34584991-34585013 TTCCTCCTGCATCTCCAAAAGGG - Intronic
1147500828 17:40961916-40961938 TACACCATGAATCTCCAGGAAGG - Intronic
1147576759 17:41605808-41605830 TGAATCCTGAGACACCAAGAAGG + Intergenic
1147879890 17:43646530-43646552 TGAATCCTGAATCTCCATGCTGG + Intronic
1148950232 17:51304495-51304517 TGAATCCTGGATCTCCAAAAAGG - Intergenic
1148955228 17:51348120-51348142 TGCAATGTGAATCTTCAAGAAGG + Intergenic
1149221255 17:54417295-54417317 TGCATTGTGAATAGCCAAGATGG - Intergenic
1149472303 17:56927116-56927138 TGAATCCTGGGTCTCCAAAAAGG - Intergenic
1151021728 17:70624851-70624873 TTCATCCTGGAACTCTAAGAGGG - Intergenic
1151326603 17:73383614-73383636 TCCAGCCTGCAACTCCAAGAGGG + Intronic
1156074406 18:33255898-33255920 GGCATCCTGAATCTCAAAAAGGG + Intronic
1156524477 18:37753808-37753830 TGCACTGTGAATCTCCAAGAAGG + Intergenic
1156650626 18:39222430-39222452 TGCATTGTGAATGTTCAAGAAGG - Intergenic
1157109929 18:44811012-44811034 AGAATGCTGAAACTCCAAGAGGG + Intronic
1158422556 18:57308778-57308800 TGAATACAGAATCTCCAAAATGG - Intergenic
1158849701 18:61483002-61483024 TGCATCCTGCATCTGCACCATGG + Intronic
1159328583 18:66957090-66957112 GGCATCCTGAATACTCAAGATGG + Intergenic
1159742851 18:72194383-72194405 TGCAGCTTGAGGCTCCAAGATGG - Intergenic
1159887554 18:73923423-73923445 TCTACCCTGAATCTCCAAGGTGG - Intergenic
1160339988 18:78081312-78081334 TGAATCCAAAATCTGCAAGAAGG + Intergenic
1161440913 19:4291204-4291226 TGGAACCTGAATCTCCCATAGGG + Intergenic
1162095217 19:8306199-8306221 TGCTTCCTAGGTCTCCAAGAGGG - Intronic
1162311847 19:9912723-9912745 TGCCTCCAGAAGCTCCAGGATGG - Intronic
1162829433 19:13275314-13275336 GTCATCCTGCAGCTCCAAGATGG - Intronic
1163300089 19:16439728-16439750 TGCACCATGAACCTCAAAGAAGG + Intronic
1163323974 19:16591408-16591430 TGCATACAGAATGTCCCAGAAGG - Intronic
1165334286 19:35158105-35158127 TGCAGCCAGCATCTCGAAGAAGG + Intronic
1165598859 19:37035689-37035711 TGCATCCTTCATCTACAAAATGG + Intronic
1166140846 19:40804345-40804367 TGAATCCTGAATAACAAAGAGGG + Intronic
1166249429 19:41557409-41557431 TACCTCCTGAATCTCCAAATTGG - Intronic
1166521867 19:43486318-43486340 TTCATCCTGAATCCACAGGAAGG - Exonic
1167053553 19:47094945-47094967 AGCATTATGAATCCCCAAGATGG - Intronic
925794067 2:7524165-7524187 TGCATCCTGAATGTCCCACCTGG + Intergenic
926142792 2:10378158-10378180 AGAATCCTGACTCTGCAAGACGG - Intronic
926719108 2:15945712-15945734 TGCATCCTCACTCTCCACGTAGG - Exonic
927702127 2:25275450-25275472 TGGATCCTGATTCTAGAAGAAGG - Intronic
928374102 2:30761103-30761125 TACACTCTGAATCTCCAAGGAGG + Intronic
928677881 2:33667716-33667738 TGAATCCTGAATCTCTAGGGTGG - Intergenic
930222726 2:48761521-48761543 TGCATTCTGGATCTCCAAGAGGG + Intronic
930249455 2:49019162-49019184 TGCATTTAGAATCTCCAAGAAGG - Intronic
932529692 2:72515777-72515799 TGCATTCTGAAGTTCCACGAAGG - Intronic
932957641 2:76372900-76372922 AGCTTCCTCCATCTCCAAGATGG - Intergenic
933818357 2:86087305-86087327 TACATCATGCATCTCCAGGAGGG + Intronic
935215803 2:100974477-100974499 AGCATCTTGACTTTCCAAGAAGG - Intronic
936496696 2:113028441-113028463 TGCATTCTCAACCTCCAAGTGGG + Intronic
938700627 2:133875961-133875983 TGGATCCTGGATCCCCAATAAGG + Intergenic
938724382 2:134094061-134094083 TACACCATGAATCTCCAAGAGGG + Intergenic
938959576 2:136329134-136329156 TGCATTATGGAGCTCCAAGATGG + Intergenic
939339270 2:140872529-140872551 TGAATCCTGGGTCTCCAAAAGGG - Intronic
940325973 2:152425199-152425221 CGCATCCTGAAAATCCAATATGG + Intronic
940400518 2:153243264-153243286 TGGATCCTGGATCCCCCAGAAGG - Intergenic
940942498 2:159578387-159578409 TGCATTATGGATCTCCAAAAAGG - Intronic
940988178 2:160070613-160070635 TGAATCCTGGGTCTCCAAAAAGG + Intergenic
941155688 2:161975363-161975385 TGCATTGTGAATCTCCAAACTGG - Intronic
941631087 2:167884978-167885000 TGCAGCCTGAGTCTCCAGGTAGG - Intergenic
942185760 2:173423340-173423362 AACATCATGAATCTTCAAGAGGG + Intergenic
942433205 2:175938761-175938783 TTCATTGTGAATCTCTAAGAGGG - Intronic
943262048 2:185678475-185678497 TGAATCCTGAGTCTTCAAAAGGG + Intergenic
943592234 2:189812476-189812498 GGCAACCTGAATCTGCAAGAAGG + Intronic
944214566 2:197241369-197241391 TGCATCATGGATCTCCAAGAGGG + Intronic
944293695 2:198037360-198037382 TGCATTTTTAATTTCCAAGATGG - Intronic
944791099 2:203128161-203128183 TGCAACCTCCATCTCCCAGAAGG + Intronic
945372941 2:209043412-209043434 TTCTTCCTGAATCTTCTAGAGGG - Intergenic
945440318 2:209870863-209870885 TGAATCCTGAATCTTAAAAATGG + Intronic
946331258 2:219010378-219010400 TGCCTCCTGAATCTGGAGGAGGG + Intronic
947783811 2:232796265-232796287 TACCTCCAGAATCTCTAAGAAGG + Intronic
1170795430 20:19542840-19542862 TTTATCCAGAATCTCCAGGATGG + Intronic
1174084595 20:47997838-47997860 TGCATCCTCACTTTCCAGGAGGG - Intergenic
1174311642 20:49660309-49660331 TGCATTGTGAATCTCCAAAAAGG - Intronic
1175855777 20:62120179-62120201 TGCACCCTGTATATCCAAGTGGG + Intergenic
1184917513 22:47580642-47580664 TGAATCCTGGGTCTCCAAAAAGG - Intergenic
1185301890 22:50085474-50085496 TGCTTCCTGAATATCAATGAGGG + Exonic
949416662 3:3822440-3822462 TGCATCCTAAATCACTGAGATGG + Intronic
949946985 3:9197861-9197883 TGAATTGTGTATCTCCAAGAGGG + Intronic
950109374 3:10408685-10408707 TGGTTTCTGAATCTCTAAGATGG + Intronic
950890229 3:16398276-16398298 AGCATCATGACTCTCCAAGAGGG + Intronic
950908337 3:16559562-16559584 AGCATCCTGAATTCCCAGGAAGG - Intergenic
950945222 3:16938693-16938715 TGCTCCCTGCATTTCCAAGAAGG - Intronic
954906963 3:54071212-54071234 AGCATCCAAAACCTCCAAGATGG + Intergenic
955379417 3:58424886-58424908 TCCATCCAGAATTTCCAAAAAGG + Exonic
955855961 3:63274344-63274366 AGCATTTTGAATCTCAAAGAGGG - Intronic
956464667 3:69507063-69507085 TGTATTCTGAAGCCCCAAGATGG + Intronic
956843736 3:73163381-73163403 TGTATACTAAATCTCTAAGATGG + Intergenic
957146815 3:76435013-76435035 TGCATCCTCAATCACCAGGTTGG - Intronic
960477894 3:118152996-118153018 TGCAAACTGATTATCCAAGAAGG + Intergenic
961261220 3:125603742-125603764 TGCATCATGAATCTTCATAAAGG + Intergenic
961587184 3:127941663-127941685 TGCAACCTCCATCTCCCAGACGG + Intronic
962060232 3:131918761-131918783 TGCACTGTGAATCTCCAAAAAGG + Intronic
962409677 3:135130009-135130031 TGCTTCCTGACTATCCAAAATGG - Intronic
962523792 3:136220363-136220385 TGCATCCTCCATCGCCAAGGAGG + Intergenic
964234671 3:154511464-154511486 TGCATTATGAATTTCCAACAGGG + Intergenic
966512869 3:180783643-180783665 TGCCTTGTGAATCTCCAGGAGGG - Intronic
967338189 3:188367734-188367756 TGCATCAAGAATCTCCACAATGG - Intronic
967403876 3:189094905-189094927 TGCATCCTGCTCCTCCAGGATGG - Intronic
968431079 4:559440-559462 TGCAAACTGAATCTCAATGATGG + Intergenic
969158126 4:5231191-5231213 TGCCTCCTGGAGCTCCAAGAGGG + Intronic
969381804 4:6804954-6804976 TGCACCCGGAACCTCCAAGAAGG - Intronic
969922491 4:10553331-10553353 AGCATTGTGGATCTCCAAGAGGG - Intronic
970227978 4:13879641-13879663 TGCATCCTGAGGGTCAAAGAGGG + Intergenic
974838194 4:67275308-67275330 TGCAGCCTGAACCTCCCTGATGG - Intergenic
977354520 4:95928090-95928112 TGAATCCTGAGTCTTCAAAAAGG - Intergenic
978514836 4:109559268-109559290 TATCTCCTGAATCTGCAAGAGGG - Intergenic
979117509 4:116845473-116845495 TGTATGCTGTCTCTCCAAGAGGG + Intergenic
979621881 4:122807163-122807185 TGCAAACTGACACTCCAAGATGG - Intergenic
980008279 4:127566165-127566187 TGGATCCTGATGCTCAAAGAAGG + Intergenic
980217155 4:129867157-129867179 CGCAGCCTCAAACTCCAAGAGGG + Intergenic
980667007 4:135953616-135953638 TGCAACCTCCACCTCCAAGATGG + Intergenic
983352044 4:166602351-166602373 TGCAGCCTGAATGGCCAAGTGGG + Intergenic
983656628 4:170090732-170090754 TCCTTCCTGAATCACCAAAATGG + Intronic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
984031365 4:174607948-174607970 TGAATCCTGGATCTCTAAAAAGG - Intergenic
984439820 4:179752633-179752655 TGCATCCTGATTTTCAAAGCAGG + Intergenic
984510582 4:180673787-180673809 TGGATCCTGATTCTACAGGATGG - Intergenic
984596480 4:181674523-181674545 TGCATTGTGAAATTCCAAGAAGG + Intergenic
984948292 4:184987096-184987118 TACATTATGACTCTCCAAGAGGG + Intergenic
986365887 5:7031086-7031108 TGAATCCTGGGTCTCCAAAAAGG + Intergenic
986546731 5:8905904-8905926 TGCAGCCTGCATCTTCACGAAGG + Intergenic
986820234 5:11458686-11458708 TACCTTATGAATCTCCAAGAGGG - Intronic
987257868 5:16175322-16175344 TTCAGCCTGGATCTCTAAGATGG - Intronic
987460312 5:18200688-18200710 TGAATCCTGGGTCTCCAAAAAGG - Intergenic
990241288 5:53819093-53819115 TTCATCCTTAATCTCCAAGCTGG + Intergenic
991094634 5:62726756-62726778 CTCATAGTGAATCTCCAAGAAGG + Intergenic
991215506 5:64154405-64154427 AGCATCCAAAACCTCCAAGATGG + Intergenic
991605818 5:68399773-68399795 TGTAGCATGAATCTCTAAGATGG - Intergenic
992641795 5:78774087-78774109 ACCATCTTGAATCTCTAAGAGGG + Intergenic
995567387 5:113445117-113445139 TCCATCCTCAGTTTCCAAGAAGG + Intronic
996522178 5:124439314-124439336 AGCATGCTGAAGCTACAAGATGG - Intergenic
997430788 5:133839418-133839440 TGCATTATGAATCTGGAAGAGGG - Intergenic
997596559 5:135111046-135111068 TGAAATCTGAATCTCCGAGATGG - Intronic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
999740405 5:154545709-154545731 TTCAACCAGTATCTCCAAGAAGG - Intergenic
1000195362 5:158952014-158952036 TTCATCCTGAAAGTCCAGGATGG + Intronic
1000659139 5:163917063-163917085 TGCATTGTGAAACTCCAAAAGGG - Intergenic
1004902870 6:20210201-20210223 AGGATGCTGAGTCTCCAAGAGGG + Intronic
1005032454 6:21523631-21523653 TGCATCCTGAATGTACACGATGG - Intergenic
1005370834 6:25130856-25130878 TGAATCCTGGGTCTCCAAAAAGG - Intergenic
1006780553 6:36629509-36629531 TGCATCATAAGGCTCCAAGAGGG + Intergenic
1008650627 6:53557704-53557726 TGAATCCTGGGTCTCCAAAAAGG - Intronic
1010024665 6:71201353-71201375 TGTATCCAGAATCACCAAAATGG - Intergenic
1010778337 6:79912261-79912283 TGCATCATGAATGACAAAGAAGG + Intergenic
1011488218 6:87865272-87865294 TGCTTTGTGAATCTCCAAGAGGG - Intergenic
1011917621 6:92527632-92527654 TGCATCATGAAATTTCAAGAGGG + Intergenic
1013658890 6:112273996-112274018 TGCATCATGAATCCCTAAAAAGG + Intergenic
1013703771 6:112807416-112807438 TGCACTCTGAATCTCCCAGAGGG - Intergenic
1014805776 6:125827758-125827780 AGCTTCCTGGATCTGCAAGATGG + Intronic
1017553026 6:155530424-155530446 AGCATCCAGAATCCACAAGATGG - Intergenic
1017986070 6:159444209-159444231 TGCAACCTGAGTCTCCCAGGAGG - Intergenic
1018340464 6:162846180-162846202 AGGATCCTGCATCTCCAGGAGGG + Intronic
1021203596 7:17753374-17753396 TGCATCCTGAATAACCAGCAGGG - Intergenic
1021327052 7:19285554-19285576 TGAATGCTGAATTTCCTAGATGG + Intergenic
1022844444 7:34195795-34195817 TGCATTGTGAATCTCCAGCATGG + Intergenic
1026549048 7:71351493-71351515 TGCTCCCTAAATCCCCAAGATGG + Intronic
1030233380 7:107232090-107232112 TGCATACTGCATGTCCTAGAAGG + Intronic
1031227527 7:119059510-119059532 TGAATCCTGGGTCTCCAAAAAGG + Intergenic
1035687531 8:1536607-1536629 TGCATCCTGACTGTCCCCGAGGG + Intronic
1036935830 8:13001753-13001775 TGCATTTTGAATCTCAAAGGAGG + Intronic
1037056531 8:14449054-14449076 TGCATCCTGAAGAGCCAAGGAGG - Intronic
1037342601 8:17862483-17862505 TGCGTTCTGAAGCTCCAAGAAGG - Intergenic
1037824935 8:22155424-22155446 TCCATCCTGGATCTCTGAGAAGG + Exonic
1037979651 8:23242394-23242416 TGAATCCTGGGTCTCCAAAAAGG - Intergenic
1039405967 8:37312781-37312803 TGTGTTGTGAATCTCCAAGAAGG - Intergenic
1040277323 8:46020701-46020723 TGCACCCCAAATCTGCAAGAAGG - Intergenic
1044220224 8:89662094-89662116 TGCATGCTGATTTTCTAAGAAGG - Intergenic
1044740608 8:95322611-95322633 TTCATTGTGAGTCTCCAAGATGG - Intergenic
1044999105 8:97864957-97864979 TTCATCCTGTCTTTCCAAGATGG + Intergenic
1045576040 8:103421181-103421203 TGCATTGTGAAACTCCAAAAGGG - Intronic
1045695521 8:104805314-104805336 TGTTTCCTGGATCTCCTAGAAGG - Intronic
1046669201 8:117039140-117039162 TGGATCCTGAAGCTCGAAAAGGG + Intronic
1047337322 8:123949238-123949260 TGCACTGTGACTCTCCAAGAGGG - Intronic
1049247082 8:141568662-141568684 GGCTTCCTGGATCTCCAAGGAGG - Intergenic
1049456028 8:142689391-142689413 TGAATCCTGGGTCTCCAAAAAGG + Intergenic
1050258898 9:3820604-3820626 TGCATTGTAACTCTCCAAGAGGG - Intergenic
1050287932 9:4122898-4122920 TGACTCCTGGATCTTCAAGACGG + Intronic
1050340932 9:4637854-4637876 TGGAAACTGAGTCTCCAAGAGGG - Intronic
1051606335 9:18920969-18920991 TGCATTATGAATCTCCAACAGGG + Intergenic
1053288007 9:36862309-36862331 TGCATCCCGATTCTCCACAAGGG + Intronic
1055800060 9:80024990-80025012 TGGATTATGAATCTGCAAGAGGG - Intergenic
1056660111 9:88536867-88536889 TTGATAATGAATCTCCAAGATGG + Intronic
1060306774 9:122420842-122420864 TGGATCCTGGATCCCCAAAAAGG + Intergenic
1060692525 9:125676923-125676945 TGTATTATGACTCTCCAAGAGGG + Intronic
1185813492 X:3132214-3132236 TGCATCCTGCCTGTCCAAGATGG - Intergenic
1186673449 X:11791288-11791310 TGCAGCCAGGATCTCCAAGATGG + Intergenic
1186902845 X:14076434-14076456 TGCAGAGTGAATCTTCAAGAGGG + Intergenic
1187200107 X:17126593-17126615 TGCTCAGTGAATCTCCAAGAGGG + Intronic
1187547587 X:20267794-20267816 TGCTACCTAAATCTTCAAGAGGG + Intergenic
1188612866 X:32120773-32120795 TGTATACTGAGTCTCCAAGGTGG + Intronic
1190477987 X:50847241-50847263 TGGATCCTGGATCCCCAAAAAGG + Intergenic
1190991517 X:55555800-55555822 AGCATACTGTATCTCCTAGAAGG + Intergenic
1193501387 X:82278890-82278912 TGAATCCTGACTCTCCAAAAAGG - Intergenic
1194044475 X:88984701-88984723 TGAATCCTGGGTCTCCAAAAAGG - Intergenic
1194440351 X:93925146-93925168 TGCATTGTGAATCTCCAAAAAGG + Intergenic
1194451464 X:94048950-94048972 TGAATCCTGGGTCTCCAAAAAGG + Intergenic
1195150928 X:102069131-102069153 CTCTTCCTGAAGCTCCAAGAAGG + Intergenic
1195275236 X:103275148-103275170 TGTATCCCGAAACTGCAAGAGGG + Intronic
1195832826 X:109078219-109078241 GGAAGCCTGAATCTGCAAGAAGG - Intergenic
1196678012 X:118440671-118440693 TGCATTTTGAATCTCCAAACAGG - Intronic
1197568566 X:128119724-128119746 TGAATCCTGGGTCTCCAAAAAGG + Intergenic
1198186360 X:134257438-134257460 TGCATCATGATTCTCCAACAGGG + Intergenic
1198561032 X:137850354-137850376 TGCAGTGTGAATCTCCAGGAGGG - Intergenic
1199388006 X:147245889-147245911 TGAATCCTGAAACACCTAGAGGG + Intergenic
1199527420 X:148808082-148808104 TGCATCATGGATCTCCAAAGGGG + Intronic
1199869064 X:151880179-151880201 TGAATCCTGGGTCTCCAAAAAGG - Intergenic
1200268450 X:154659427-154659449 TGCCGCCTGTATCTCCAACATGG - Intergenic
1201268107 Y:12228325-12228347 TGGATCCTGCCTGTCCAAGATGG + Intergenic