ID: 1120813730

View in Genome Browser
Species Human (GRCh38)
Location 14:88831303-88831325
Sequence GGGTGGGCCAATGCAAATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 4, 2: 8, 3: 27, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120813730_1120813738 4 Left 1120813730 14:88831303-88831325 CCCTAATTTGCATTGGCCCACCC 0: 1
1: 4
2: 8
3: 27
4: 89
Right 1120813738 14:88831330-88831352 ATTTGCATGTAATTGAAAGTGGG 0: 26
1: 115
2: 189
3: 287
4: 465
1120813730_1120813737 3 Left 1120813730 14:88831303-88831325 CCCTAATTTGCATTGGCCCACCC 0: 1
1: 4
2: 8
3: 27
4: 89
Right 1120813737 14:88831329-88831351 AATTTGCATGTAATTGAAAGTGG 0: 22
1: 98
2: 205
3: 271
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120813730 Original CRISPR GGGTGGGCCAATGCAAATTA GGG (reversed) Intronic