ID: 1120813730

View in Genome Browser
Species Human (GRCh38)
Location 14:88831303-88831325
Sequence GGGTGGGCCAATGCAAATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 4, 2: 8, 3: 27, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120813730_1120813738 4 Left 1120813730 14:88831303-88831325 CCCTAATTTGCATTGGCCCACCC 0: 1
1: 4
2: 8
3: 27
4: 89
Right 1120813738 14:88831330-88831352 ATTTGCATGTAATTGAAAGTGGG 0: 26
1: 115
2: 189
3: 287
4: 465
1120813730_1120813737 3 Left 1120813730 14:88831303-88831325 CCCTAATTTGCATTGGCCCACCC 0: 1
1: 4
2: 8
3: 27
4: 89
Right 1120813737 14:88831329-88831351 AATTTGCATGTAATTGAAAGTGG 0: 22
1: 98
2: 205
3: 271
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120813730 Original CRISPR GGGTGGGCCAATGCAAATTA GGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
904387572 1:30154070-30154092 GGGTGGGACAATTCAAAGCAGGG + Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906234412 1:44195870-44195892 GGGTGGACTAATGCCAATTGAGG - Intergenic
917527934 1:175805791-175805813 GAATGGGCCAATGCAAATTCTGG + Intergenic
923202460 1:231725492-231725514 GGGTGAGCTAGTGCAAATTGAGG - Intronic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1065869989 10:29947911-29947933 GGGTGGCTCAATGCAACTGATGG + Intergenic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1070374294 10:75814184-75814206 TGGTGAGCCACTGCATATTAGGG - Intronic
1076379820 10:130017266-130017288 GGGTGGGCCAATGCCAGCTGGGG + Intergenic
1078940566 11:16000425-16000447 AGGTAGGCAAATGCAAAATATGG + Intronic
1082663219 11:55941141-55941163 GGGTGTGCGAATGAAAATAAAGG - Intergenic
1084451514 11:69241583-69241605 GGATGGGCCCATGCAAATGAAGG - Intergenic
1090344200 11:126054805-126054827 GGGTGGGCCAATGGTACATAGGG + Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1102894504 12:116587910-116587932 TGGTGGGCCAATGTAAACTATGG - Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1108048451 13:46405723-46405745 AGGTGGGCTAATGCAAATTTAGG - Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1110114722 13:71798675-71798697 TGCTGGTCCAAAGCAAATTAAGG - Intronic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1113698960 13:112368813-112368835 TGTTGGGGAAATGCAAATTAAGG + Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121559227 14:94862195-94862217 GGATGGGACTATGCAAATCATGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1125092455 15:35810321-35810343 GCGTGGGCCAATGCCTAATAAGG + Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1143950158 17:10626032-10626054 GGGTGAGCCTCTCCAAATTAAGG - Intergenic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1155583894 18:27343014-27343036 GGGTAGGCCAATGGTAATCATGG - Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159246992 18:65819232-65819254 GAGTGGGTCAATGCAGATTGAGG - Intronic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1162840002 19:13349396-13349418 AGCTGGGCCAAGGCAAATTGGGG - Intronic
1166513337 19:43426206-43426228 GTGTGGATTAATGCAAATTAAGG - Intergenic
926961706 2:18364731-18364753 TGGTGGGACAATGCAAAGTTTGG - Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931817703 2:65921008-65921030 GGGTGGGCCAGCGCTACTTAAGG - Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
938306571 2:130260503-130260525 GTTTGGGCCAATGCGACTTAAGG + Intergenic
942067030 2:172281142-172281164 GGAAGGGCCCATGCAAATGAAGG + Intergenic
944407851 2:199405540-199405562 TGGAGGGCAAATGCAAATGATGG + Intronic
944742842 2:202629130-202629152 AGGTGGGCCCATGGAAGTTATGG + Intergenic
1169215898 20:3794778-3794800 GGGTGGGCCAATGCATCTGAAGG - Intronic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173403820 20:42747769-42747791 GGGTGGGGCATTACAAATCAAGG + Intronic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1175425928 20:58866538-58866560 GGCTGGTCAGATGCAAATTAGGG - Intronic
1177355761 21:20004702-20004724 GGATGAGTCAATGCAAATTGAGG - Intergenic
1177674904 21:24284645-24284667 GGGTGGCCAAATGCAAGTGATGG - Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1180703795 22:17796470-17796492 GGATGGGCAAATTCAAATGAGGG + Intronic
1181836453 22:25613984-25614006 GGGTGGGGCGATGATAATTATGG - Intronic
1185242915 22:49755981-49756003 GGATGGGCCAATGCAAATTGAGG - Intergenic
950132129 3:10554448-10554470 GGGTGGGCCAATGGAATACAAGG + Intronic
952454999 3:33464590-33464612 GGGTGGGACAATTCAAAGCAGGG - Intergenic
957437047 3:80191398-80191420 GGCTGGACCAATGAATATTAGGG - Intergenic
957526105 3:81380360-81380382 GGTTGGGCCAATGCAACTTGTGG + Intergenic
962562168 3:136617807-136617829 GGGTGGGCAAATAAAAATTTTGG + Intronic
962804875 3:138919824-138919846 AGGTGGGACAATGCAAAGCATGG - Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
977046828 4:92078831-92078853 GGGTGAGCCAAAGCAGAGTAGGG + Intergenic
978440627 4:108729921-108729943 GGGTGGGGCAATGCATATGGAGG + Intergenic
983228223 4:165105049-165105071 GGGTGGCACAATCCAGATTAGGG - Intronic
984385573 4:179052988-179053010 GGGTGGCTCAGTACAAATTAGGG - Intergenic
984588860 4:181594422-181594444 GGGTGGACCAATGCTGATGAAGG - Intergenic
985046738 4:185948352-185948374 GGGAGGGCTAATGTATATTAGGG - Intronic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
988936640 5:36090059-36090081 GGGTGGCCCAATGCAAATTAAGG + Intergenic
997065367 5:130553511-130553533 AGGTGGGTCAATGGATATTAAGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1000042280 5:157493614-157493636 GGGTGGGGCAGTGTGAATTAAGG - Intronic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1003933094 6:10946462-10946484 GGGTAGGCCAATGGAATTCAAGG - Intronic
1004124479 6:12859187-12859209 GGGTAAGCCAATGAAAATAATGG + Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011382194 6:86754211-86754233 GGGTGGGCCTATTAAAAATACGG + Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1015742620 6:136473324-136473346 GGGTAGGCCATTGCAGTTTAGGG - Intronic
1019029090 6:168995046-168995068 GGGCGGGCCAATGCCAATGGAGG + Intergenic
1021320802 7:19208464-19208486 GTGTGGGCCAGTACAAATCATGG - Intergenic
1021391858 7:20102641-20102663 GGGTGGGACAAGATAAATTAGGG + Intergenic
1023507302 7:40913396-40913418 GGGTGGACTAATGGAAATTTGGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1028557453 7:92138930-92138952 TGCTGGGACAATGCAAATTCAGG + Intronic
1029269732 7:99369913-99369935 GGGTGGGCCAAGGCAGACCAGGG - Intronic
1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG + Intronic
1030784917 7:113647016-113647038 GGATTGGACAATGCAAAGTATGG - Intergenic
1045438537 8:102187972-102187994 GAGTGTGCAAATGCAAATTCTGG + Intergenic
1049598870 8:143498049-143498071 GGGTGAGCGAATGCAAGTGAAGG + Intronic
1051011160 9:12416231-12416253 GGGCGAGTCAAAGCAAATTAAGG + Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG + Intergenic
1058310618 9:103497056-103497078 GGTCAGGCCAATGCAAATCAAGG + Intergenic
1062218572 9:135402390-135402412 GGGTGGGCAAAGGGAACTTAAGG - Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1198660586 X:138964233-138964255 GGGAAAGCCAATGCAAATAAAGG + Intronic
1199385219 X:147215680-147215702 AGGTGGGACAATTCAAAGTAGGG + Intergenic
1200246109 X:154526664-154526686 GGGTGGGCAAAGGCAACTTGGGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1200810530 Y:7479801-7479823 GGGTGAGCCAAAGCAGATCAGGG - Intergenic