ID: 1120813817

View in Genome Browser
Species Human (GRCh38)
Location 14:88832076-88832098
Sequence AATGAGAGGCCTAATGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120813817 Original CRISPR AATGAGAGGCCTAATGAGTA GGG (reversed) Intronic
902690970 1:18109934-18109956 AAGGAGAGGACTGATGAGAAGGG + Intronic
905786772 1:40764668-40764690 AATGAGCTGCCTAAAGAGTCTGG - Intronic
909981191 1:82103441-82103463 TATGTGAGTCCTAATGAGTTAGG + Intergenic
911216379 1:95200080-95200102 AGTAAGAGGCCTAAAGAATAAGG + Intronic
912248897 1:107990733-107990755 TATGAGAGGCATTATGAGCAAGG + Intergenic
919946395 1:202322195-202322217 AATAAAAGGTCTAAAGAGTAGGG + Intergenic
1063960733 10:11303350-11303372 AATGACTGGACTAATGAGAAAGG + Intronic
1065422325 10:25559008-25559030 AAATAGAGAGCTAATGAGTAGGG - Intronic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1069357840 10:67608102-67608124 TTTGAGAGGCCAAATGAGTTAGG + Intronic
1073523680 10:104159266-104159288 AAAGAGAGGCCAAAGGAGTTGGG + Intronic
1077535423 11:3121836-3121858 AAGGAAAGGCCTCATGAGGAAGG + Intronic
1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG + Intergenic
1078952552 11:16150929-16150951 AATCAAAGGGCTAATGAGTTGGG + Intronic
1082888520 11:58113465-58113487 AATGAGGGGGGTAATGAGTTGGG - Intronic
1082921862 11:58504296-58504318 AATGAGAGACCTTGTGCGTAGGG - Intergenic
1085852186 11:80134215-80134237 AATGAAAGGCCAAATCAGAAAGG - Intergenic
1090171169 11:124605986-124606008 AAGGAGAGGCCTATGCAGTAAGG + Intergenic
1091146552 11:133285077-133285099 AATGAGAGACCTCATGAGGAAGG + Intronic
1091511515 12:1131788-1131810 AGTGAGAGGCCAAAACAGTAGGG + Intronic
1096860097 12:54519963-54519985 AGTGAGAGGCCTAGAGAATAGGG + Intronic
1098155586 12:67594366-67594388 GATGAGGTGCCAAATGAGTAAGG + Intergenic
1106431519 13:29685189-29685211 AATGAGAGGAGCAAAGAGTAAGG - Intergenic
1110738978 13:78972227-78972249 AAAGAGAGGCTTAATGAGGGAGG - Intergenic
1113321454 13:109236304-109236326 AATGAGAAGCACAATGACTATGG + Intergenic
1114522710 14:23348932-23348954 AATAAGAGGCCTGATGGGAAAGG - Intronic
1116135324 14:40915728-40915750 AATGAGAGACCTATAGAGAATGG - Intergenic
1118456106 14:65946843-65946865 AAAGAGAGGCCATATGAGTCAGG + Intergenic
1118486567 14:66219719-66219741 AATGAGATGACTGATGACTAGGG - Intergenic
1120813817 14:88832076-88832098 AATGAGAGGCCTAATGAGTAGGG - Intronic
1121466849 14:94121313-94121335 AATGAGAGGCCAAATGAGAGGGG + Intergenic
1121726988 14:96159492-96159514 ACAGAGAATCCTAATGAGTAAGG + Intergenic
1126456390 15:48866619-48866641 CACGAGAGAGCTAATGAGTAGGG - Intronic
1126787972 15:52194065-52194087 AATCAGAGGAAAAATGAGTAAGG + Intronic
1127940473 15:63690222-63690244 AATCAGAGGTCTAAATAGTAAGG - Intronic
1138416181 16:56872628-56872650 AAAGCAAGGCCTGATGAGTAAGG - Intronic
1138760426 16:59537242-59537264 AAATAGAAGCCTAAGGAGTACGG + Intergenic
1140330517 16:74052504-74052526 AGTGAAATCCCTAATGAGTAAGG + Intergenic
1140376669 16:74450357-74450379 AATGAGGGACTTAATGAGTGCGG + Intergenic
1141438826 16:84016316-84016338 AATGAGATGTTTAATGAGTGAGG + Intronic
1144327794 17:14198272-14198294 GTTGAGAGGCCTAATGCGTGTGG - Intronic
1150276584 17:63901793-63901815 ACTGAGATTCCTAATGACTAGGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1162543376 19:11312048-11312070 TCTGAGTGGCCTAATGAGTTGGG + Intronic
1164141116 19:22464680-22464702 AATGAGAGGTCTAAAAATTAAGG + Intronic
1168485293 19:56756513-56756535 AATGAGAAGGCTAATGGGAATGG + Intergenic
1168527884 19:57103367-57103389 GATGAGAGGGGTAATGAGAAGGG - Intergenic
925304962 2:2841715-2841737 AAGCAGAGCCCTCATGAGTAAGG + Intergenic
927017605 2:18981593-18981615 AAAGAGAGGGCAAATCAGTAGGG + Intergenic
927407929 2:22793327-22793349 AAGCAGAGGCCTAATGTGTAGGG - Intergenic
930436818 2:51354760-51354782 AAAGTGAGGTCTAATTAGTAGGG + Intergenic
930726717 2:54688747-54688769 ACTGAGAGGACTCAGGAGTAGGG - Intergenic
931404359 2:61962089-61962111 GATTAGAGGCCTTGTGAGTATGG + Intronic
938561438 2:132475604-132475626 AATCAGAGCCCTAACGAGTAAGG - Intronic
940804651 2:158173208-158173230 GAAGAGAGACCTAATGAGAAAGG + Intronic
941775087 2:169384682-169384704 ATTGAGGAGCCAAATGAGTAAGG - Intergenic
943294997 2:186127070-186127092 CATGAAAGACCTAATGAGAAAGG + Intergenic
943471647 2:188301691-188301713 AATGAGAGGACTAAGGGGAATGG + Intronic
944542357 2:200766099-200766121 AATGAGACGACTCATGAGGAGGG - Intergenic
945512182 2:210716364-210716386 AATGAAAGGCCTTATGGGTCAGG - Intergenic
947062203 2:226179602-226179624 AATGAGAAGCCTGATAAGGAAGG + Intergenic
1176984132 21:15416691-15416713 AATGAGGGGACCAAAGAGTATGG + Intergenic
1182704357 22:32266926-32266948 AATGACTGGTCTAATGAGTGTGG + Intergenic
1185305583 22:50113657-50113679 AATGAGTGGCCTCATGAACAGGG - Exonic
949863863 3:8531231-8531253 TATGAAAGGCATGATGAGTAGGG - Intronic
951033065 3:17904342-17904364 AATGACAGGCCTACACAGTATGG - Intronic
951424096 3:22521673-22521695 AATGAGAAGCCTAAGAAGTTTGG - Intergenic
951746061 3:25978705-25978727 AATGAGAGGCCTACGGAACAGGG + Intergenic
952868858 3:37879334-37879356 AATGAGAGCCCTGATGAGACAGG - Intronic
955542211 3:59989330-59989352 AATGAAAGTCCTAATGTGTGGGG - Intronic
958164537 3:89862729-89862751 AATGAGATGACTGATGACTAGGG + Intergenic
962102363 3:132356307-132356329 AATGAGAAGCCTAAAAAGAAGGG + Intronic
962891396 3:139676184-139676206 ACTGAGAGGCCCAGAGAGTAGGG - Intronic
967487849 3:190054987-190055009 ATTGGGAGGCCTAATGAACATGG - Intronic
969158858 4:5237635-5237657 AATGTGAGGCTTAATGAGAATGG + Intronic
970956785 4:21821821-21821843 TATAAGAGGCTTAATGAATAGGG - Intronic
974747835 4:66099466-66099488 AATTACAGGCCTAGTGATTAGGG - Intergenic
976304717 4:83548350-83548372 AATCAGATGCCCAAAGAGTAAGG - Intronic
976413652 4:84746365-84746387 AATGAGATTAGTAATGAGTAGGG + Intronic
976832558 4:89331695-89331717 AATCAGAGGTCTTATGGGTAAGG - Intergenic
979294592 4:119016882-119016904 AATGAGAGCCCTAATTTGTGGGG - Intronic
983188047 4:164723317-164723339 AATGAGAGCCCTAAAGAGTTTGG - Intergenic
984411153 4:179399597-179399619 AATGAGATGACTAATTAGTGTGG - Intergenic
986348041 5:6852709-6852731 AATGAGTGGGCCAATGAGAAAGG - Intergenic
996288306 5:121821940-121821962 AATGTCAGGCTTAATGAGAAAGG - Intergenic
998506325 5:142675262-142675284 AATGAGAGGCCTAACGACCCAGG + Intronic
999186043 5:149709729-149709751 AATGAGAGGCTTGAGGAGTCAGG - Intergenic
1004628789 6:17401554-17401576 AATGTCTGGCCTAATGAGTTAGG + Intronic
1007207742 6:40166236-40166258 AATGAGATGTCTGAAGAGTATGG + Intergenic
1010570513 6:77467950-77467972 AATGTGAGGGCCAATGAATATGG - Intergenic
1013064723 6:106672505-106672527 AATGAGAGGCCTAACAGGCAGGG + Intergenic
1015333395 6:132007047-132007069 AAGGAGTGGACTAATGAGGACGG - Intergenic
1015999258 6:139027206-139027228 AATGATAGGAATAATGAGTCTGG - Intergenic
1018518265 6:164612546-164612568 AATGAGAGGAAAAGTGAGTAGGG + Intergenic
1019255985 7:51449-51471 ATTGAGAACCCTAATAAGTATGG + Intergenic
1023288324 7:38642880-38642902 AGTGACAGGCCTAATGACAAGGG + Intergenic
1024987621 7:55209016-55209038 AATCAGAGGCCTAGTGAGAGTGG - Exonic
1026614334 7:71888137-71888159 AAGAAGAGGGCTAAGGAGTAGGG + Intronic
1028614699 7:92753315-92753337 AATGCGAGCCCTCATGAGTATGG - Intronic
1030837085 7:114301893-114301915 AATGAGCTGCCTAAAAAGTATGG - Intronic
1032875363 7:136032708-136032730 TATGAGAGAGATAATGAGTAAGG + Intergenic
1033489727 7:141830726-141830748 AATAAGAGGCCAAAGGAGAAGGG - Intergenic
1034010907 7:147528441-147528463 AGTGAGAGACAGAATGAGTAAGG - Intronic
1046612468 8:116441127-116441149 AATGAGAGGTCACACGAGTAAGG - Intergenic
1047891727 8:129319348-129319370 AAAGAGAGGACTAATTAGGATGG - Intergenic
1048220886 8:132541087-132541109 AATGAGACCCCTACTGAGCACGG + Intergenic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1049434708 8:142581151-142581173 AAGGAGGGGCCTCATGAGTGCGG + Intergenic
1051218349 9:14822537-14822559 AATGCTAGGCTTAATTAGTATGG - Intronic
1051399633 9:16665783-16665805 AATGAAATGCCTACTTAGTAAGG - Intronic
1052020286 9:23517981-23518003 AAGGAGAGGACTACTTAGTATGG + Intergenic
1189969979 X:46408275-46408297 AGTGAGAGGCCTAAAGAGCCAGG + Intergenic
1190464456 X:50712070-50712092 AATGAGAGCTATATTGAGTAGGG + Intronic
1193369385 X:80676401-80676423 AATTTAAGGCCTAATGAGTAAGG + Exonic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic