ID: 1120815193

View in Genome Browser
Species Human (GRCh38)
Location 14:88849452-88849474
Sequence TCATATTTAGATACCTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120815193 Original CRISPR TCATATTTAGATACCTTGGG TGG Intronic
903608855 1:24595260-24595282 CCATTATTAGATACCGTGGGTGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
907299942 1:53480808-53480830 TCATATTTAGACACAAGGGGAGG + Intergenic
909135621 1:71796278-71796300 TCCTATTTACATACCTGGGCTGG + Intronic
911607854 1:99928742-99928764 TTATATATATATAGCTTGGGAGG + Intergenic
912146545 1:106800819-106800841 TCATAATTAAGTACCTAGGGTGG - Intergenic
914937022 1:151990571-151990593 ACAAATTTAGTTACCTTAGGAGG + Intronic
915640891 1:157225199-157225221 TCATTTTTGAATTCCTTGGGTGG + Intergenic
919947293 1:202328828-202328850 TCTTATTTAGATAGCTTTTGGGG + Intergenic
921409184 1:214816109-214816131 TCATATGTAATGACCTTGGGGGG - Intergenic
923578510 1:235184478-235184500 TTAGATTTAACTACCTTGGGGGG - Intronic
1064657131 10:17567552-17567574 AAATATTTCAATACCTTGGGAGG + Intergenic
1069191015 10:65489767-65489789 TTATATTTAAATAGCTTTGGGGG - Intergenic
1072319524 10:94234924-94234946 TCATTTTTAAACACCTTGGAGGG - Intronic
1073825754 10:107318746-107318768 TTATATTTGAATACCTTGGGTGG - Intergenic
1074908840 10:117888838-117888860 TCAGAGTTAGATACCTTAGTTGG + Intergenic
1090392897 11:126400965-126400987 TAATATTTAGTAACCATGGGGGG + Intronic
1099701711 12:86092290-86092312 TAATATTTATATATCTTGGAAGG + Intronic
1100542422 12:95570644-95570666 TCACAAGTAGATACATTGGGGGG - Intergenic
1105150536 13:17261781-17261803 GGATATTTGGATAGCTTGGGAGG + Intergenic
1110172609 13:72520277-72520299 TGATATTTAAATACCTTGGCAGG + Intergenic
1110828456 13:80001030-80001052 TCCTATTTAGATTTCTTGGAAGG - Intergenic
1112963366 13:105156648-105156670 TCAAATTTATATTCCTTGGATGG - Intergenic
1113429059 13:110233438-110233460 TCAAAGTCAGATACTTTGGGGGG + Intronic
1118407488 14:65441104-65441126 TCTTATTTAGATAACTAGGAAGG + Intronic
1119338493 14:73854396-73854418 TCAAATATAGATAACTTGGCTGG - Intronic
1120815193 14:88849452-88849474 TCATATTTAGATACCTTGGGTGG + Intronic
1124415251 15:29468289-29468311 TCACATTTAGGTACCATTGGTGG - Intronic
1128432068 15:67605855-67605877 TCATATCTAGCTACTTTGCGAGG + Intronic
1128445324 15:67754730-67754752 TCACACTTAGATACCTATGGTGG - Intronic
1129853240 15:78807121-78807143 TCATCTTTAGCTGCCTTGGCTGG - Intronic
1137960686 16:52879108-52879130 TCATATTTTAATACTTTAGGCGG - Intergenic
1138400084 16:56738779-56738801 TAAACTTTTGATACCTTGGGTGG + Intronic
1138811557 16:60156831-60156853 TTAAATTCAGATACTTTGGGAGG + Intergenic
1147409179 17:40236861-40236883 TAAAAGTTAGAAACCTTGGGAGG - Intronic
1151068914 17:71185845-71185867 TCATATTTAGATAATTTGCGTGG + Intergenic
1153687141 18:7557620-7557642 CCATAGTTGTATACCTTGGGCGG + Intergenic
1154538175 18:15494514-15494536 GGATATTTGGATACCTTGGAGGG + Intergenic
1155668159 18:28336153-28336175 TCATATTAGGATACTTTGAGTGG - Intergenic
1158724958 18:59962403-59962425 TCAAATTTCGATACCAGGGGAGG - Intergenic
1159316537 18:66781929-66781951 TTATATTTAGTTTCCTTTGGTGG - Intergenic
1162592808 19:11604061-11604083 TCATATTTACGTACTTTGGGAGG - Intronic
1164049743 19:21574820-21574842 TCATATGTACATACATTGGAAGG + Intergenic
1164379313 19:27718591-27718613 TCCTATTAAAATGCCTTGGGTGG + Intergenic
925246182 2:2385400-2385422 TCACATTTAAATACCTGGGAGGG + Intergenic
926294756 2:11560979-11561001 TCATAATTAGCTTCCTTGTGGGG + Intronic
927796100 2:26050440-26050462 TCATAATTACGTACCTTGGTAGG + Intronic
928658465 2:33477281-33477303 TCATATTTAGATTTCTTGCATGG + Intronic
930251818 2:49043008-49043030 TCATTTGTAGATATCTTGGATGG - Intronic
933042257 2:77484249-77484271 TCTTATGTAGATAACTTGTGTGG + Intronic
934147692 2:89111563-89111585 TCCACTTTAGAAACCTTGGGAGG + Intergenic
934221583 2:90089038-90089060 TCCACTTTAGAAACCTTGGGAGG - Intergenic
938110486 2:128560976-128560998 TCATATGTAGATAACTTTTGTGG - Intergenic
943974593 2:194457632-194457654 TCATATTTATATAACAGGGGAGG - Intergenic
946357847 2:219199853-219199875 TTATATTTATATACATTGGGAGG + Intronic
946514595 2:220397865-220397887 GCATAATTATATACCCTGGGAGG - Intergenic
1170009817 20:11710485-11710507 TCATATTAAGTTGCTTTGGGAGG - Intergenic
1171486047 20:25487103-25487125 TAATCTTTAGTTACCTTGGGTGG - Intronic
1173195161 20:40908190-40908212 TCTTATTTAAATACCTTGAGGGG - Intergenic
1173479021 20:43384502-43384524 TCATCTTTTGATACCTGGGCAGG - Intergenic
1175073524 20:56354801-56354823 TCATATTTTAATACCTTGAAAGG + Intergenic
1177390642 21:20465671-20465693 TCACATATAGATAATTTGGGGGG + Intergenic
1180938132 22:19639395-19639417 TGATGTTTTGATATCTTGGGAGG + Intergenic
953814785 3:46146107-46146129 TCTTATAAAGATACCATGGGAGG - Intergenic
955917345 3:63919902-63919924 GCATATTTACATACCATGAGGGG - Intronic
957560430 3:81814099-81814121 TTATATATAGATACCTTAAGTGG - Intergenic
959192795 3:103137005-103137027 TCATATTTAGAGATCTTCAGAGG + Intergenic
962541676 3:136389050-136389072 GAATATTTAGACACTTTGGGAGG - Intronic
963542704 3:146614349-146614371 TGATATTTAGTTACCTTAGTGGG + Intergenic
963702589 3:148644721-148644743 TAAAATGTAGATACCTTAGGTGG - Intergenic
966324020 3:178734119-178734141 ACATAATGAGATAACTTGGGAGG + Intronic
969954588 4:10875482-10875504 TAAAATTAAGATTCCTTGGGAGG + Intergenic
970044991 4:11842019-11842041 TCATATTGAGATACATTGTGTGG - Intergenic
974433409 4:61827750-61827772 TCTAATTTAGATAATTTGGGTGG + Intronic
977324032 4:95552396-95552418 TCATAATTTGATAACTTGAGAGG - Intergenic
979355701 4:119701338-119701360 GCATATTTAGATACTGTGGAAGG + Intergenic
983159366 4:164392508-164392530 TAATATTTAGATTCCTTGTTTGG - Intergenic
993831770 5:92769020-92769042 TAATAGCTAGATACATTGGGAGG + Intergenic
994857134 5:105136644-105136666 TCATGTTTATAAACCTTGGTGGG - Intergenic
999186146 5:149710900-149710922 TCTTATATAAATACCTAGGGTGG + Intergenic
1001131839 5:169070675-169070697 GCATCTTTAAATACCTTGGAAGG - Intronic
1004358891 6:14953747-14953769 ACATATTTAAATACCGTGGACGG - Intergenic
1004361052 6:14971640-14971662 AAATATTTAGATACATTGGCCGG + Intergenic
1004812699 6:19277077-19277099 TCAGATTTAGATACCCTGTTAGG - Intergenic
1006584745 6:35101425-35101447 TCAGATTTAGAAACCTTTTGAGG - Intergenic
1008543967 6:52569515-52569537 TCACTTTTAGATACCTTGTGAGG - Intronic
1009460474 6:63906866-63906888 TCATATTGAAATATCTTGGATGG + Intronic
1012874560 6:104711329-104711351 TCAAATTTAAACACTTTGGGTGG - Intergenic
1014797310 6:125740740-125740762 TCATAGTTAGATTCCCTTGGTGG + Intergenic
1018719502 6:166562033-166562055 TCATGTTTAGAGATCTGGGGAGG + Intronic
1018835859 6:167483523-167483545 TCATATTTAGATTTCTTGGAAGG + Intergenic
1022362252 7:29672657-29672679 TCATTATTACATGCCTTGGGAGG - Intergenic
1023702834 7:42909942-42909964 TCTATTTTAGATACCTTAGGAGG - Exonic
1024309114 7:47952947-47952969 TGATATTTAAATACCTTGATAGG + Intronic
1027510563 7:79074214-79074236 TCATATTTAGATGCCTAAGATGG - Intronic
1030724102 7:112904876-112904898 TCATATTTTGATATTTTGGGAGG + Intronic
1031180583 7:118409706-118409728 TCAGATTTGGATACCTTTTGGGG + Intergenic
1031568941 7:123334230-123334252 TCATATTTAGGAACTTTCGGTGG - Intergenic
1031665622 7:124479234-124479256 TAATATTTAGATACATGGTGAGG - Intergenic
1034925357 7:155117139-155117161 TTATATTCAAATACCTTGGGAGG + Intergenic
1035338321 7:158144250-158144272 TCATTTTTATAAACCTTGGGGGG - Intronic
1039253602 8:35693737-35693759 ACATATTGAAATATCTTGGGGGG - Intronic
1040687774 8:49896107-49896129 ACATATTTTGTTACCTTGTGTGG + Intergenic
1047919077 8:129614555-129614577 ACAGATTTAGATAGCTTGGAGGG - Intergenic
1049456168 8:142690780-142690802 TCATATTTGGTAACCATGGGGGG - Intergenic
1051127891 9:13824741-13824763 TCATAGTCAGATAGATTGGGAGG - Intergenic
1056818601 9:89820316-89820338 TCATAGCTAAATATCTTGGGTGG - Intergenic
1057521253 9:95762355-95762377 TCATAGTGAGCTACCTTGTGGGG + Intergenic
1061344157 9:130008694-130008716 TCATATTTAGACAGCTTTCGTGG - Intronic
1203595773 Un_KI270747v1:134378-134400 TGATATTTAGATAGCTTTGAAGG + Intergenic
1186044829 X:5524388-5524410 TCATAATTAAATACCTTGTATGG - Intergenic
1189052581 X:37662153-37662175 ACATTTTTAAATACCTTGTGTGG + Intronic
1195386708 X:104320496-104320518 TCTGATTTAAATACCTTTGGTGG + Intergenic
1197899492 X:131354832-131354854 CCATATTTAGAAACCTAGAGTGG + Intronic