ID: 1120815675

View in Genome Browser
Species Human (GRCh38)
Location 14:88855274-88855296
Sequence AAGGAGATGAAAAATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1485
Summary {0: 1, 1: 0, 2: 15, 3: 130, 4: 1339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120815675 Original CRISPR AAGGAGATGAAAAATGAAGA AGG (reversed) Intronic
900356369 1:2266755-2266777 AATGAGATAGAAAATGAAGATGG + Intronic
900738817 1:4317910-4317932 AAGGATAAGATAGATGAAGAGGG + Intergenic
900748635 1:4379007-4379029 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
900850011 1:5135401-5135423 CAGGAGGTGAATAATGAGGAGGG - Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901754597 1:11433946-11433968 GAGGAGATGATCAATGGAGAAGG + Intergenic
902261164 1:15225986-15226008 AATGAGAAGAAAAATAAAGCTGG + Intergenic
902662448 1:17914518-17914540 AGGAAGATGAAGTATGAAGAGGG - Intergenic
902748768 1:18491910-18491932 AAGGAGATGGATAATGACGGTGG - Intergenic
903077083 1:20779239-20779261 CATGAGAAGAAAAATAAAGACGG + Intronic
903207640 1:21794950-21794972 AAGGAGGTGGAGAATCAAGAGGG - Intergenic
903225830 1:21893846-21893868 AAGGTGAAGAAAAAGGCAGAGGG + Intronic
903295338 1:22339828-22339850 AAGGAGAAGACAAATCAACAAGG - Intergenic
903454747 1:23479583-23479605 AAGAATATTAAAAATTAAGAAGG + Intronic
903960511 1:27054212-27054234 AAGGAGAGGAAAAAAAAAGATGG - Intergenic
903986132 1:27230387-27230409 AAGGAGAAGAAAGAAGAAGATGG - Intergenic
904104714 1:28069572-28069594 AAGAAGAAGAAAAAAAAAGAGGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904406829 1:30296601-30296623 AAGGATAGGAAAAATGAGGCTGG + Intergenic
904797849 1:33070858-33070880 AAGGAGGAGGAAGATGAAGAAGG + Intronic
904848831 1:33441526-33441548 AAGGAGGAGAAAGAGGAAGAAGG - Intergenic
905054439 1:35080720-35080742 GAAGAAATGAAAAAAGAAGACGG - Intronic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905630731 1:39516831-39516853 ATGGAGATAAAAACTGACGAGGG + Intronic
905667029 1:39769339-39769361 ATGGAGATAAAAACTGACGAGGG - Intronic
905929752 1:41778809-41778831 AAGGAGATGGAGCATGATGAGGG + Intronic
906051358 1:42876983-42877005 CAGGAGCTGAAAAATAAAGTGGG - Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906338525 1:44956558-44956580 AAGCAGATAAAAAATAAAAATGG + Intronic
906449438 1:45932347-45932369 AAGTAAGTGAAAAATGAATAGGG - Intronic
906504381 1:46367212-46367234 TTGGAGATGAAGAATGCAGATGG - Intergenic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
907089166 1:51708501-51708523 AAGCAGATGAAACATTAATAAGG - Intronic
907233606 1:53024368-53024390 ATGGAGATGAAAGGTGATGATGG + Intronic
907584202 1:55601767-55601789 AAGAAGAAAAAAAATAAAGAGGG - Intergenic
907730867 1:57064183-57064205 AATGAGATGAAAAATGTCAAAGG - Intronic
907838452 1:58133490-58133512 AAGGAGCTTAGAGATGAAGATGG - Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908804031 1:67911194-67911216 AAGGAGAGGAGAAAGGAACATGG - Intergenic
909128107 1:71700903-71700925 AAAGAGATGAAAAATGATAAAGG + Intronic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909346449 1:74593237-74593259 AATGACATGAAAAGGGAAGAAGG - Intronic
909399008 1:75205027-75205049 AAGGAGAATAAGAATGCAGAAGG + Exonic
909476519 1:76086990-76087012 AATGAGATGAAAAATAAATAAGG - Intronic
909604042 1:77490851-77490873 CAGGCAATGAAAAATGGAGAAGG - Intronic
910126441 1:83847921-83847943 AACTAGATGTAAAATGAAGGAGG + Intergenic
910163294 1:84297551-84297573 AAGGAGAAGGAAAAGGCAGATGG - Intergenic
910164811 1:84315056-84315078 AAAGAGAAGAAAAAGAAAGAAGG - Intronic
910361788 1:86419767-86419789 AAAGAGATGAAAAATAACCAGGG - Intergenic
910376638 1:86579264-86579286 AAGGAAAAGACAAGTGAAGAAGG + Intronic
910384209 1:86664234-86664256 AAGGAGAGGAGCACTGAAGAAGG + Intergenic
910534393 1:88279846-88279868 AAGGAATTGAAAAATGGAGATGG - Intergenic
910979507 1:92945229-92945251 AAGGCTATGATAAAGGAAGATGG + Intronic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911104625 1:94119996-94120018 AAGGAGCTGAAAGAGGAAGGAGG - Intronic
911319413 1:96394742-96394764 AAGCAGATGTGAAATGAACAAGG - Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
912044952 1:105442551-105442573 AAGGACTTGAAAAATGCAGGAGG + Intergenic
912135906 1:106659876-106659898 AAGGAGAGGGAATAGGAAGAAGG + Intergenic
912245402 1:107956938-107956960 AAGGAAATGAAAACTGAATCAGG + Intronic
912571512 1:110627661-110627683 AAGGAAAACAAAAAGGAAGAAGG + Intronic
912601824 1:110943425-110943447 AAGGAGCAGAAAAATAAAAAAGG + Intergenic
912723793 1:112041734-112041756 ACAGAGATGAGAAAGGAAGAAGG - Intergenic
912953589 1:114137071-114137093 AAGCACATGAAACATGAACAAGG + Intronic
913153141 1:116065654-116065676 AAGGAGGTGGAAAAGGGAGAAGG - Intronic
913247457 1:116882639-116882661 AAAGATGTGAAAAATGAGGAGGG + Intergenic
913288900 1:117253773-117253795 AAAGAGAAGAAAAAAGAAAAAGG - Intergenic
913330100 1:117659946-117659968 AAGCAGATAAAGAATGCAGAAGG + Intergenic
913457983 1:119053219-119053241 AAGAAGAGGAAAAATGGAGAAGG + Intronic
913940315 1:125097714-125097736 AAAGAGAAGAGAAAGGAAGATGG - Intergenic
914251541 1:145926026-145926048 AAGAGGAGGTAAAATGAAGAGGG - Intergenic
914384670 1:147156786-147156808 AACAAGATGAAAAGAGAAGATGG + Exonic
914402714 1:147338430-147338452 AAGGACAAAAAAAATGAATAAGG - Intergenic
914460328 1:147877868-147877890 GAGGATATGAAAAGTGAGGAAGG + Intergenic
914493164 1:148166996-148167018 AAAGAGATGAAATACTAAGAAGG + Intergenic
914511154 1:148333340-148333362 AAGAAGAAAAAAAATAAAGAAGG + Intergenic
915386132 1:155494173-155494195 AAGGAGGTGAAAGACAAAGATGG + Intronic
915444074 1:155964908-155964930 AAGAAAAAGAAAAATAAAGAAGG + Intronic
915616393 1:157042854-157042876 AAGAGGATGAAAAGGGAAGAAGG + Intronic
916175675 1:162036279-162036301 TAGGAGATGTAAAAGGAAGGGGG - Intergenic
916449499 1:164906619-164906641 AAGGGGTTTAAAGATGAAGAAGG + Intergenic
916616262 1:166444203-166444225 AAGAGGAGGAAAAAAGAAGAAGG + Intergenic
916651102 1:166835540-166835562 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
916961992 1:169897598-169897620 GAGTAGATGAAGAGTGAAGAGGG - Intergenic
917255711 1:173114097-173114119 AAGGAGATTGAAGATGAAGATGG - Intergenic
917304150 1:173609606-173609628 AAGGAGGTCAAAGATAAAGAGGG + Exonic
917338791 1:173953200-173953222 AAGTAGAAGAAAAATAAAAAAGG - Intronic
917389769 1:174522518-174522540 AAAGAAAAGAAAAAAGAAGAGGG + Intronic
917534738 1:175866051-175866073 AAGGAGACAAACATTGAAGATGG - Intergenic
917628303 1:176867989-176868011 AATGAGAAAGAAAATGAAGAAGG - Intronic
917717666 1:177754391-177754413 GTGGAGAGGAGAAATGAAGAAGG + Intergenic
917725820 1:177826209-177826231 AAGGAGAAGAAACCTGAAGATGG - Intergenic
917749294 1:178039787-178039809 ATGGAGAGCAAAAATGAAGTAGG + Intergenic
917917230 1:179714645-179714667 AAGGAGATGAGAGAGGAAAAAGG - Intergenic
918209743 1:182340169-182340191 AAGGAAATGAGCAAGGAAGATGG + Intergenic
918256859 1:182756479-182756501 ATGGGGATAAAGAATGAAGATGG + Intergenic
918371212 1:183863291-183863313 AAGAAGAAGAAAAAAGAAAAAGG - Intronic
918389955 1:184049115-184049137 AAAGAGTTGAAGAATGAAAAGGG - Intergenic
918595410 1:186287208-186287230 AAGGGGAAAAAAGATGAAGATGG - Intergenic
918771429 1:188565660-188565682 AAGTAGATGAAACATCAACAAGG + Intergenic
918797640 1:188924022-188924044 AATGTGATGAAAAATAAAGAGGG + Intergenic
918906905 1:190507716-190507738 AATGAGATGAAATCTGAAGAAGG + Intergenic
919106076 1:193152610-193152632 AAGGAAAAGAAAAATGAAACAGG - Intronic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919226071 1:194703801-194703823 AAGGTGATGAAAAATCTTGAGGG + Intergenic
919303776 1:195803678-195803700 AATTAGATTAATAATGAAGAAGG - Intergenic
919372248 1:196742300-196742322 AGGGAGATGAAGATTGAAGTGGG + Intronic
919392429 1:197003892-197003914 AAGGAGATAATTCATGAAGAAGG + Intronic
919408706 1:197216724-197216746 AATGAGGTCAAAACTGAAGAGGG + Intergenic
919486252 1:198151184-198151206 AAGGAGAGGACAAATAAAAACGG + Intergenic
919553003 1:199015721-199015743 AATGAGTTGTAAAATGAATAAGG - Intergenic
919586021 1:199441396-199441418 AAGGAGTAAAAAAAGGAAGAAGG + Intergenic
919625495 1:199905917-199905939 AAAGACAAGAAAAATGAAGGAGG - Intergenic
920007754 1:202845692-202845714 AAAGAGATGAAAACTCAACACGG - Intergenic
920080542 1:203369634-203369656 CAGGAGAGGAAAAATGACAAAGG - Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920274788 1:204796087-204796109 AAGGCAAAGAAAACTGAAGAAGG + Intergenic
920691405 1:208149613-208149635 AAGGAGGTGAAAGGTGGAGAGGG + Intronic
920875428 1:209830023-209830045 AATGAGATGTTAAATGAAAAAGG - Intronic
921027469 1:211300043-211300065 AAGAAAAAGAAAAATGCAGAGGG - Intronic
921178084 1:212610150-212610172 AAGTAGATGAGAAATGAAAATGG - Intronic
921311053 1:213843795-213843817 AAAGAAAGGAAAAAGGAAGATGG - Intergenic
921524108 1:216195620-216195642 AAGGGCATGAAAAAAAAAGATGG + Intronic
921541364 1:216420168-216420190 AAACAGAAGAAAAATGAATAGGG - Intronic
921622722 1:217343934-217343956 AAGGAGATGAGAAAAGAGCAAGG + Intergenic
921734512 1:218612031-218612053 AAGCAGATGAAGAAGGAAAAAGG - Intergenic
922029961 1:221788331-221788353 TAGGAGATTAATAAAGAAGACGG + Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922982724 1:229841436-229841458 AAGGAGTTGAAACAGGATGAGGG - Intergenic
923220669 1:231889738-231889760 GAGAAGATGAAAAAAAAAGAGGG - Intronic
923378675 1:233392648-233392670 AAGGAGAAGGAAAAGGAAAAGGG - Intergenic
923455829 1:234164409-234164431 AGGGAGAGGAAAAAGAAAGAGGG - Intronic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923856594 1:237851549-237851571 AAGGAGATGGTAAATGAATATGG + Intergenic
923963594 1:239110251-239110273 AAGGAGATGAACAATGGGGAGGG + Intergenic
924020490 1:239776569-239776591 AAAGAGATGAAAAGAAAAGAAGG + Intronic
924147694 1:241094005-241094027 AAGGAGATGAAGAAACCAGAAGG + Intronic
924175519 1:241387622-241387644 AAGGAGATGAGAGATCAAGTGGG - Intergenic
924947449 1:248855951-248855973 AAGGAGAACAAAGAGGAAGATGG + Intronic
1062784770 10:254956-254978 AAGTAGATGAAAACAGCAGAGGG - Intergenic
1063029355 10:2216712-2216734 CTGAATATGAAAAATGAAGATGG + Intergenic
1063224036 10:3997935-3997957 AAACAGATTAAAAATGTAGAAGG + Intergenic
1063283924 10:4662259-4662281 AAGAAGATTAAAAAGGAAGGGGG - Intergenic
1063309046 10:4935740-4935762 AAGTTGATGAAAAATAAATATGG + Intronic
1063350959 10:5354657-5354679 AGGGAGAAGAAATATGGAGAAGG - Intergenic
1063737928 10:8782323-8782345 AAGGAAAAGAAAAATGAAGGAGG + Intergenic
1064278405 10:13928833-13928855 AGGGAGAGGAAAAAGGAAGCTGG - Intronic
1064317484 10:14271653-14271675 AAGAAGATGAACAAAGAAGAAGG - Intronic
1064615352 10:17148362-17148384 AAGTACATACAAAATGAAGAAGG + Exonic
1064635611 10:17363363-17363385 AGGGAGCTCAAAAAGGAAGATGG - Intronic
1064708934 10:18103192-18103214 AATGAGTTGAAAAAATAAGATGG - Intergenic
1064720077 10:18220075-18220097 AAGGAGAAGAGGAATTAAGATGG - Intronic
1065002296 10:21348050-21348072 CAGGTGAAGAAAAATGATGATGG - Intergenic
1065035277 10:21631657-21631679 CAGGAGAGAGAAAATGAAGAGGG + Intronic
1065085841 10:22175315-22175337 AAGACGAGAAAAAATGAAGAAGG + Intergenic
1065253503 10:23840999-23841021 AAGGAAATGAAAATTCAGGAAGG - Intronic
1065652593 10:27908574-27908596 AAGCAGATGAAAAAAGATAAAGG + Intronic
1065837387 10:29671076-29671098 AAATAGATGAAAAGTGAAGTCGG - Intronic
1065850113 10:29780792-29780814 AAGGAAAAGAAAAAGGAAAAAGG - Intergenic
1065906687 10:30260685-30260707 AAGGAGATAAAAAATAATTAGGG + Intergenic
1066308287 10:34169374-34169396 CAGGAGATGACAAAAGAAGCTGG + Intronic
1066539419 10:36429196-36429218 AGGGAGAAGAAAAAAGCAGAGGG - Intergenic
1066646021 10:37609965-37609987 AGGGAGAGGAAAAAAGCAGAGGG - Intergenic
1067011340 10:42716766-42716788 AAGAAAATGAAAAATGGAAATGG - Intergenic
1067150034 10:43724243-43724265 AAAGAAATGAACAATGTAGAAGG + Intergenic
1067270973 10:44791032-44791054 TGGGAAATGAAAAATGGAGAGGG - Intergenic
1067304061 10:45042787-45042809 AAGGAGATAAAAATGGAAGAAGG - Intergenic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1068113080 10:52704838-52704860 AAAGAGATGAAAGAGAAAGAAGG - Intergenic
1068123946 10:52814770-52814792 AAGTAGAAGGAAAAAGAAGAAGG - Intergenic
1068135106 10:52944912-52944934 AAGGAAATATAAAATGAACATGG - Intergenic
1068177782 10:53484771-53484793 AAGCAGATGAAAATGGAAAATGG - Intergenic
1068398118 10:56490443-56490465 AGGCAGATGAATGATGAAGAAGG + Intergenic
1068476514 10:57533390-57533412 AAGGAGACTAAAAAAGAAAAGGG + Intergenic
1068731000 10:60357740-60357762 CTGGAAGTGAAAAATGAAGAGGG - Intronic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070694789 10:78554073-78554095 GAGGAAATGAGAAAGGAAGAAGG - Intergenic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070906334 10:80076759-80076781 AAGGAGGAGAAGAATAAAGAGGG + Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1070958120 10:80478322-80478344 GAGGAGATGAATAATAAATAAGG + Intronic
1071067117 10:81648803-81648825 AAGGAAATTAAAAATTAAAAGGG - Intergenic
1071124953 10:82323012-82323034 AAGGAGAAGAAAAAGGAAAAAGG + Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071773900 10:88763030-88763052 AAAAAGATGCAAAATGAACACGG - Intronic
1071797534 10:89022447-89022469 AAGAAGTAGATAAATGAAGAGGG - Intergenic
1071841775 10:89478944-89478966 AAGGCAATGGAAAATTAAGATGG - Intronic
1072929965 10:99653645-99653667 AAAGAGATGAAAAAAGCGGAAGG - Intergenic
1073021561 10:100448968-100448990 AAGGAGAAGAAAGAAGAAGAAGG + Intergenic
1073089227 10:100919883-100919905 AAGTAGATGAAACCTGAAGGAGG - Intronic
1073234880 10:102005548-102005570 AAGGAGAGAAAGAATAAAGAAGG + Intronic
1073539161 10:104304205-104304227 AAGAAGAAGATAAATGAAAATGG - Intronic
1073625496 10:105091572-105091594 AATGAGATGAAAAGTAAGGAAGG - Intronic
1073748233 10:106494270-106494292 GAGGAGAAGAAAAAAGAAAAAGG - Intergenic
1074123965 10:110513642-110513664 AAGTAAAAGAAAAATAAAGATGG - Intergenic
1074149358 10:110744409-110744431 AAGGTGATGAAAGGTGAAGGTGG + Intronic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074490257 10:113933570-113933592 AAAGAAAAGAAAAAAGAAGAGGG - Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075957248 10:126534672-126534694 ACGGAGTAGAAAAATGAAGGTGG - Intronic
1075970974 10:126652206-126652228 GAAGAGATGAAGCATGAAGAGGG - Intronic
1076192562 10:128492968-128492990 AAAGAGATGAAAAAGGTGGAGGG + Intergenic
1076330379 10:129660135-129660157 AGGGAGATGAAAAATCAGAATGG - Intronic
1076590002 10:131576527-131576549 AAGCTGATGAAAGAGGAAGACGG + Intergenic
1077346630 11:2061123-2061145 TGGGATATGAAAAATGGAGAAGG - Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077832399 11:5888174-5888196 ACGAAGATCAAAAATAAAGAGGG + Intronic
1077870188 11:6255938-6255960 GATGAGATAAAAAATGAATAAGG - Intergenic
1078327142 11:10389853-10389875 AAGGAGAAGAACAAAGAAAATGG - Intronic
1078588940 11:12621000-12621022 AAGGAAATGAAAGAGGAAGAAGG + Intergenic
1078593351 11:12665127-12665149 AAGGAGAAGAAAGAAGGAGAAGG + Intergenic
1078903912 11:15666727-15666749 AAGCAGATTAAAAATGAGAATGG - Intergenic
1079082807 11:17425630-17425652 TAGGAACTGAGAAATGAAGAGGG - Intronic
1079816059 11:25059919-25059941 AAGGAAGGGAAAAATGAAAAAGG + Intronic
1080109663 11:28551826-28551848 AAGGTGAGGAAGAATGGAGAGGG + Intergenic
1080228631 11:29989949-29989971 ATGCAGATGGAAAATGAAGGAGG + Intergenic
1080350940 11:31385321-31385343 AAGGAGTTGTAAAATCAAAAAGG - Intronic
1080499367 11:32853857-32853879 AAGAAGAAGAAAAGAGAAGAAGG + Exonic
1080648305 11:34203283-34203305 AATGAGATAAAAAGTGAATATGG + Intronic
1080693266 11:34577775-34577797 AAGCAGATGAAAAGTAAAGAAGG + Intergenic
1080956324 11:37099937-37099959 AGGGATAGGAAAAAAGAAGAAGG - Intergenic
1081336622 11:41874611-41874633 AAGGAGAGGAAACAAGAAGGTGG + Intergenic
1081404731 11:42683837-42683859 AATCAGAAGAAAGATGAAGATGG + Intergenic
1081507445 11:43733093-43733115 AAGGTAATGAAAAATAAAGTTGG + Intronic
1081970246 11:47193434-47193456 AAGCAGATGGAAGATGAAGCTGG + Intergenic
1082262411 11:50087104-50087126 AAAGACCTGAACAATGAAGATGG - Intergenic
1082757602 11:57093141-57093163 AATGAGATGGAAAATGCCGAGGG - Intergenic
1083516857 11:63267941-63267963 AAGAAGAAGAAAAAAGAAGAAGG - Intronic
1084449451 11:69227188-69227210 CAGGAGCTGAAAATTTAAGAAGG + Intergenic
1084583985 11:70044544-70044566 ATGGAAATAAATAATGAAGAAGG + Intergenic
1084723088 11:70921496-70921518 AAGGAGTAGAAAAATGAATGAGG + Intronic
1085027536 11:73245320-73245342 AAGGAGGTGATAAAAGAAGAGGG + Intergenic
1085068925 11:73523748-73523770 AATGAGATAGAAAAGGAAGAGGG - Intronic
1086302507 11:85442909-85442931 AAGAAGAAGAAAGAAGAAGAAGG + Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086740670 11:90364207-90364229 AAAGAGAGGAAAATGGAAGAAGG + Intergenic
1086875241 11:92087922-92087944 AGGGAGAGGAAAGATGGAGAGGG - Intergenic
1087086474 11:94224083-94224105 AAGGAGAGGAAAACAGATGAAGG - Intergenic
1087215753 11:95491716-95491738 AAGGAGATGTATAACCAAGAAGG - Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087859259 11:103133291-103133313 ACGGAAAGGAAGAATGAAGAAGG - Intronic
1087968402 11:104448773-104448795 AAGGAGAGGAAAAAGGAAGATGG + Intergenic
1087976552 11:104556793-104556815 AAGGAGATGAGAGAAGAAGTAGG - Intergenic
1088231597 11:107678791-107678813 AGTGAGATGGAAAATGAATACGG - Intergenic
1088429205 11:109739680-109739702 CATGAGATGAAAAATGAATAGGG - Intergenic
1088528359 11:110780975-110780997 ATGGAGATGTAAAAAGAAAAAGG - Intergenic
1088622024 11:111694811-111694833 AAGGGGAAGAGAAATGAAGAGGG - Intronic
1089498651 11:118920348-118920370 AATGAGATTAAACATCAAGAAGG + Intronic
1089766662 11:120772571-120772593 AAGGAGGTCAAAAAAGGAGATGG + Intronic
1089884427 11:121805838-121805860 AAGGAGATGAAAAATACAAAAGG - Intergenic
1089910314 11:122092404-122092426 AAGGAGAGAAATAAAGAAGAAGG + Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464632 11:126923319-126923341 AAGGAGAAGGAAGAAGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090766230 11:129878557-129878579 AAAGAGATAAAAAAATAAGAAGG + Intronic
1090796156 11:130137189-130137211 AAGGAGATTAAAAAAGAAAATGG - Intronic
1090817068 11:130307484-130307506 AAGTAGAGTAAAAATCAAGATGG - Intronic
1090935481 11:131338076-131338098 AATGTGAAGAAAAAAGAAGAGGG - Intergenic
1091417381 12:300122-300144 AATGAGATGGAAAATTAACAAGG + Intronic
1091756993 12:3060084-3060106 AAGGAGTATAAAAGTGAAGATGG - Intergenic
1091953739 12:4618341-4618363 AAGGAGATGGATAATTCAGAGGG + Intronic
1092295522 12:7194980-7195002 AAGGACATGGAAACTTAAGAAGG + Intronic
1092584368 12:9881590-9881612 GAAGAGATGGAGAATGAAGATGG + Exonic
1092963917 12:13623511-13623533 AAGGAGATGAAAATTAGAGCAGG - Intronic
1093145985 12:15567433-15567455 AAGGAGAAGAAAAAGAAAGCTGG - Intronic
1093708244 12:22298950-22298972 AAGGATATTACAAATGTAGACGG + Intronic
1094026197 12:25961791-25961813 GATGAGATGAAAAATGGAGGGGG - Intronic
1094187669 12:27662478-27662500 AAATAGGTGAGAAATGAAGAGGG + Intronic
1094754979 12:33457273-33457295 AAAGAGATGGAAAATGTAAAAGG + Intergenic
1094806990 12:34103614-34103636 AAGAAAATAAAACATGAAGAAGG + Intergenic
1095125832 12:38475069-38475091 AAGAAAATAAAACATGAAGAAGG + Intergenic
1095196858 12:39329455-39329477 AAGGAGGAGAAAGATGAAGAAGG + Intronic
1095376618 12:41536775-41536797 AAGAAGAAGAAAAATCAAGAAGG - Intronic
1095417162 12:41989674-41989696 GAGGAGAGGTAACATGAAGATGG + Intergenic
1095545625 12:43364685-43364707 AAGAAGAAGAAAAATGAATAGGG + Intronic
1095638995 12:44465645-44465667 TGGGAGATCAAAAATGTAGAAGG + Intergenic
1095647582 12:44566308-44566330 AAGAAAATTAAAAATGAAAACGG + Intronic
1095785829 12:46108008-46108030 AAGGAAATGAAAAATAATCAAGG - Intergenic
1095922754 12:47546983-47547005 AAGGAAGTGCAAAAAGAAGAAGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096387269 12:51203219-51203241 GAGGAAATGAGATATGAAGATGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096646664 12:53041944-53041966 AAGGAGAGTAGACATGAAGAGGG - Exonic
1096692990 12:53332720-53332742 AAGGAGTGGAAAAAAGAAAAGGG + Intronic
1096900102 12:54868455-54868477 AAGCAAATGAAAAAAAAAGAAGG - Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097098260 12:56567445-56567467 AAGAAGAAGAAAGAAGAAGAAGG + Intronic
1097191341 12:57220973-57220995 AAGGACCAGAGAAATGAAGATGG - Intronic
1097268012 12:57756702-57756724 AAAGAGATGAAAGATGGAAAGGG - Intronic
1097332261 12:58344264-58344286 AAGAAGAGGAGAGATGAAGAAGG + Intergenic
1097380418 12:58888927-58888949 AACAAGATTAAAAATGTAGATGG - Exonic
1097392997 12:59038687-59038709 AGTGAGATGAAAATTGCAGAAGG - Intergenic
1097480348 12:60116371-60116393 AAGGAGATGAAGAATAAAGGTGG + Intergenic
1097967145 12:65593604-65593626 AAGGGGAAAAAAAGTGAAGAAGG - Intergenic
1097968742 12:65609624-65609646 AAGGAAAAGGAAAATAAAGAGGG - Intergenic
1097993290 12:65859580-65859602 AAGCAGCTGAAAATGGAAGAAGG - Exonic
1098178560 12:67820410-67820432 AAAAAGATCAAAAAAGAAGAAGG - Intergenic
1098246046 12:68518979-68519001 AAGAAGATGAAAAAGAGAGAAGG + Intergenic
1098495915 12:71135457-71135479 AAGCAGGAGAAAAAAGAAGAAGG + Intronic
1098503450 12:71221690-71221712 AAGGTGATCAAAAACAAAGAAGG - Intronic
1099356606 12:81645208-81645230 AAGGAGAAGAAAGAGAAAGAAGG + Intronic
1099608988 12:84841358-84841380 AAAGAAAAGAAAAACGAAGAAGG + Intergenic
1099938559 12:89157725-89157747 AAGGAAATGGAAAATGATTATGG - Intergenic
1100117500 12:91325172-91325194 AAGGAGAGGAAGAAAGATGAAGG + Intergenic
1100158606 12:91831451-91831473 AAGGAATTAAAAAATAAAGAAGG + Intergenic
1100222371 12:92519331-92519353 AAGGAGATGATACATGAGGTAGG + Intergenic
1100363165 12:93896378-93896400 AAGGAGATTAGCAATGAAGAGGG + Intergenic
1100638445 12:96458383-96458405 AAGGAGATGTAGAAAGAAAAAGG - Intergenic
1100897333 12:99198371-99198393 AAAGAGTTGAAAACTGAAAAAGG + Intronic
1101228163 12:102710538-102710560 GAGAAGATGAAAAACAAAGAAGG - Intergenic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101638831 12:106570548-106570570 AAGGAAATGAAAAGGAAAGAAGG - Intronic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1101843148 12:108342102-108342124 AAGGAGATGAAAAGAGGAGGAGG + Intergenic
1102075998 12:110060650-110060672 AAGTAGATGAGAAAGCAAGAGGG - Intronic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102767096 12:115443046-115443068 ATGGAGAGGAAAAAGGAACAGGG - Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103263332 12:119608465-119608487 AATGAGAAGGAAAATGAAGGAGG + Intronic
1103480854 12:121248889-121248911 AAGGGGCGGAAACATGAAGACGG + Intronic
1104085905 12:125474046-125474068 AAGGAAAGGAAAAAGAAAGAAGG - Intronic
1104212360 12:126701449-126701471 AAGGAGTTAGAAAATGATGATGG + Intergenic
1104559651 12:129832257-129832279 AAGGAGAGGAAAAAGGGGGAGGG + Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105650028 13:22367167-22367189 AAGGAAATGAGAAAGAAAGACGG - Intergenic
1105681976 13:22737256-22737278 AAGGAAATTAAAGATGAAGTAGG - Intergenic
1107007205 13:35626288-35626310 AAGGAAATGAAAATAGGAGATGG + Intronic
1107041151 13:35949018-35949040 AATGAAATGTAAAATGAAAATGG - Intronic
1107161546 13:37234921-37234943 AAGAAAATGAAAAATAAAAAAGG + Intergenic
1107318871 13:39164997-39165019 AACGATATGAAATATGAAGGAGG + Intergenic
1107758485 13:43651240-43651262 AAGAGGAAGAAAAAGGAAGAGGG + Intronic
1107880454 13:44827742-44827764 GAGGAGATGAAAATTAATGAAGG - Intergenic
1108051528 13:46445763-46445785 AAAGAGAAGAAAAAGGAAGTTGG + Intergenic
1108177460 13:47807871-47807893 AAGGAGATGAAAACTGATGAAGG + Intergenic
1108195564 13:47991255-47991277 TAGGAGATAAAAAGTGTAGAGGG - Intronic
1108312309 13:49206624-49206646 AATGAAATGGAAAATGAATAAGG - Intronic
1108620514 13:52178874-52178896 AAGGAAATGCAAAATGCATAGGG - Intergenic
1108666237 13:52634175-52634197 AAGGAAATGCAAAATGCATAGGG + Intergenic
1108682279 13:52790512-52790534 AAAGAGAGGAAAATGGAAGATGG - Intergenic
1108700093 13:52936407-52936429 AAGGAAAAGAGAAATGAAGCAGG + Intergenic
1108730730 13:53232758-53232780 AAGGAGGGAAAAAAGGAAGAAGG + Intergenic
1108892969 13:55284796-55284818 AAGGAGAAGAAAGAAGAAGCAGG + Intergenic
1108993808 13:56699127-56699149 CAGCAGATGAACAATCAAGAAGG - Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1109225227 13:59685702-59685724 AAAGAGATGATAAATAGAGATGG + Intronic
1109544081 13:63819388-63819410 AAAGAGAAGAAAAAGGAAGTTGG + Intergenic
1109574864 13:64242070-64242092 AAGGTCATGGAAAATGAGGAAGG + Intergenic
1109607804 13:64720497-64720519 AATGAGATGGAAAATTAACAAGG + Intergenic
1109812978 13:67539902-67539924 AGGGAGATAAAGAATGCAGAAGG - Intergenic
1109914724 13:68967678-68967700 AAGGAGAGAAAAAAGAAAGAAGG - Intergenic
1109971725 13:69779344-69779366 AAGGAAAGGAAAAAAGAGGAGGG - Intronic
1110017832 13:70431040-70431062 AAGTAAATGGAAAATAAAGATGG - Intergenic
1110104599 13:71655793-71655815 AAGCAAATGAAAAAGAAAGATGG - Intronic
1110292287 13:73821139-73821161 AAGGAGATGAAGAAGTTAGAAGG - Intronic
1110403389 13:75120596-75120618 AAGGAAATGAAGAAGGAAAAAGG + Intergenic
1110423962 13:75344293-75344315 GAGGAAAAGAAAAATAAAGAAGG + Intronic
1110564712 13:76946644-76946666 AAGGAGAAGAAAAAGGTAGAAGG + Intergenic
1110665766 13:78115993-78116015 AAGGAGAAGAAAAAGCAAAAGGG - Intergenic
1110777616 13:79427651-79427673 AAGGAGTTAAAAAAAGAAAAAGG - Intergenic
1110842258 13:80156436-80156458 AAAGAAAAGAAAAATGAAGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111148050 13:84210456-84210478 AAGAAAATGAAAAGAGAAGAAGG - Intergenic
1111244096 13:85512090-85512112 AAGAAGACCAAATATGAAGAGGG + Intergenic
1111276200 13:85950632-85950654 AAGGAGGAGAAGAATGAAGCTGG - Intergenic
1111480897 13:88824940-88824962 AAGGAGATGAGAGAAAAAGAAGG - Intergenic
1111744945 13:92255804-92255826 AAAGAGATAAAAAATGGATAAGG - Intronic
1112136896 13:96589218-96589240 AAACAGATCAAAAATGAATAAGG - Intronic
1112137199 13:96593595-96593617 CTGGAGCTGAAAAATGAAGTGGG - Intronic
1112374914 13:98830266-98830288 AAGGAAAAGGAAAATAAAGATGG - Intronic
1112404350 13:99105102-99105124 AAGAAGAAGGAAGATGAAGAGGG - Intergenic
1112509185 13:99993616-99993638 TAGGAGGGGAAAAATGAAGTAGG - Intergenic
1112560297 13:100506772-100506794 TAGGAGGAGAAAAAGGAAGAGGG + Intronic
1112578248 13:100656342-100656364 AAGAAGGTGGAAAATTAAGAAGG + Intronic
1113293501 13:108931905-108931927 AAGGAAGAAAAAAATGAAGAAGG - Intronic
1113331425 13:109331746-109331768 AAGCAGATGGAAAATGAAGGCGG + Intergenic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1114481188 14:23035822-23035844 AAAGATTTGAAAAATGAAGGTGG - Intergenic
1114684325 14:24513798-24513820 AAGGAAATGACAAATCAAGCTGG - Intergenic
1114856765 14:26456260-26456282 AAAGGGGTGAAAGATGAAGATGG + Intronic
1114876037 14:26719401-26719423 AAGCAGAAGTAAAATGTAGAGGG + Intergenic
1114931113 14:27467828-27467850 AAGGAGAAGAAACAGGCAGAGGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115699312 14:35934645-35934667 AAGAAGATTAAAAAAGAAAACGG + Intergenic
1116019846 14:39447094-39447116 AAGGAGAAAAAAAATTAAGGAGG + Intergenic
1116220754 14:42084608-42084630 CTGGAGCTGAAAAATGAAGTTGG - Intergenic
1116291009 14:43040626-43040648 GAGGAGATGACATATAAAGAAGG + Intergenic
1116579495 14:46621075-46621097 AACGAGATAGAAAATGAACAAGG + Intergenic
1116782559 14:49251881-49251903 CAGAAGATGAAAGATGAAAATGG + Intergenic
1116827150 14:49683701-49683723 AAGGAAAGGAAAAATGAGGCAGG + Intronic
1116991371 14:51280531-51280553 AATAACATGACAAATGAAGAGGG - Intergenic
1117055926 14:51911897-51911919 AAGGAGTTGAATCATGAAAAGGG + Intronic
1117457250 14:55910918-55910940 AAGGAGAGGGAAAATCAATAAGG - Intergenic
1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG + Intronic
1118435779 14:65769855-65769877 AAGAAGAAGAAAAAAAAAGACGG + Intergenic
1118514712 14:66513998-66514020 AAGGAAATGAAATATGATGAAGG + Intronic
1118547347 14:66906208-66906230 AAGGAGATGCTAAATCATGATGG - Intronic
1119080662 14:71690619-71690641 AAGGAAATGTAATTTGAAGAAGG - Intronic
1119110533 14:71969614-71969636 AAGGAGGAAAAGAATGAAGAAGG - Intronic
1119157652 14:72425914-72425936 TAGAATATTAAAAATGAAGAAGG + Intronic
1119300126 14:73565368-73565390 AAGGAAAAGAAAAAGGGAGAGGG - Intergenic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1119923602 14:78470681-78470703 AAAGAGAAGAGAAATGGAGATGG + Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120084759 14:80258854-80258876 AATGACATAGAAAATGAAGAAGG - Intronic
1120114660 14:80600163-80600185 AAGGAGAGGAAAAAGAAAGTGGG + Intronic
1120610370 14:86634335-86634357 AAGAAGAAGAAAAATGGAGAAGG + Intergenic
1120613232 14:86668603-86668625 AAGGAAAAGAAAAAGGAAGAGGG - Intergenic
1120698862 14:87675729-87675751 AATAAAATGAAAAATGAACAGGG + Intergenic
1120737677 14:88072027-88072049 ATGGAGATTAAAAGTGATGAGGG + Intergenic
1120813959 14:88833988-88834010 AAGGATATGAAAAATAAAGAAGG + Intronic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1120974230 14:90234881-90234903 AAGGAGATGAAAATTAAAATTGG + Intergenic
1121067660 14:90983644-90983666 AAGAAAAAGAAAAAGGAAGAAGG + Intronic
1121642876 14:95497857-95497879 AAAAAGATGAAGAATGAAGCCGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122315950 14:100826244-100826266 AAGGATGTGCAAAAGGAAGACGG + Intergenic
1122322259 14:100862145-100862167 AAGGAAAGGAAAAAGGAAGGAGG - Intergenic
1122322286 14:100862253-100862275 AAGGAGAAGAAAAAGAGAGAGGG - Intergenic
1122628306 14:103095472-103095494 AATGAGTTGACAACTGAAGAAGG + Intergenic
1122736410 14:103846287-103846309 AAGGAAATCAAAGAGGAAGAAGG + Intronic
1123507138 15:20954383-20954405 AGAGAGATGAAAACTGAAGGGGG - Intergenic
1123564365 15:21528130-21528152 AGAGAGATGAAAACTGAAGGGGG - Intergenic
1123600618 15:21965413-21965435 AGAGAGATGAAAACTGAAGGGGG - Intergenic
1123785964 15:23673806-23673828 TAGGGAATGAATAATGAAGATGG - Intergenic
1123966460 15:25464665-25464687 AAAGACAGGAAAAAAGAAGATGG - Intergenic
1124049340 15:26180432-26180454 ATGGAGTTGATAAAGGAAGAAGG + Intergenic
1124199441 15:27665735-27665757 AAGGAAATGAAAAATAATGAAGG - Intergenic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124697859 15:31881261-31881283 AAGAAAAGGAAAAATAAAGATGG + Intergenic
1124867447 15:33506875-33506897 AAAAAGAGGAAAAATAAAGAAGG + Intronic
1124882156 15:33652631-33652653 AATGAAATGAAAAATGAAAATGG - Intronic
1125144057 15:36445579-36445601 GAGGAGATAATAAATGAAAAGGG - Intergenic
1125319393 15:38468038-38468060 AAGGATCTGCAAAAGGAAGAAGG + Intronic
1125420745 15:39501583-39501605 GAGGAGATGACTAATGAAAAAGG + Intergenic
1125710996 15:41786336-41786358 AAGTAGAAAAAAAATAAAGATGG + Intronic
1125819459 15:42615707-42615729 AAGGAGATTAAAAAAAAAAAAGG + Intronic
1125916465 15:43492683-43492705 AAGGTGATGAAAAATAGGGAGGG - Intronic
1125998575 15:44187892-44187914 AAGGAGATGAAATTTGAACCAGG - Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126273580 15:46849394-46849416 AAAGAGAGGAAGTATGAAGATGG - Intergenic
1126629966 15:50724273-50724295 AAGACTAAGAAAAATGAAGAAGG + Intronic
1126630013 15:50724583-50724605 AAAAAAAAGAAAAATGAAGAAGG + Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127205731 15:56716252-56716274 AAAGAGATGTAAAATGACAATGG + Intronic
1127313888 15:57776759-57776781 AAGGAGAGGAAGAATCAAGGAGG + Intronic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127546854 15:60000424-60000446 AAGGAGATGCAAAAAGCAGAAGG + Intergenic
1127770688 15:62227672-62227694 AATAAGATGAAAAAATAAGAGGG + Intergenic
1127815174 15:62602282-62602304 AAGCAGATGAAAAAATATGACGG - Intronic
1127946801 15:63763523-63763545 AAGGAAAAGAAAAATGGAGGAGG + Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095843 15:64954846-64954868 AAGGAGAAGAAAGAAGAAGAAGG - Intronic
1128131065 15:65227522-65227544 AAGGAGATAAAAAGGGAACAAGG - Intergenic
1128143585 15:65319175-65319197 AAGAAGAGGAAAAAGAAAGAAGG - Intergenic
1128573011 15:68749435-68749457 AAGTAGATTGAAAAAGAAGAAGG + Intergenic
1128586653 15:68858155-68858177 AAGGAGAGGAAAAAGAAAGATGG - Intronic
1128617481 15:69121547-69121569 AAGGAGAAGAGAAGTAAAGAAGG - Intergenic
1129086800 15:73102441-73102463 AACAAGATGGAAAGTGAAGAAGG - Intronic
1129551886 15:76460338-76460360 AAATAGCTGAAAAATTAAGAAGG - Intronic
1129892118 15:79078264-79078286 AAGGAGATGGAAAAGGGAGCTGG - Intronic
1129916716 15:79280657-79280679 AAGGAGATGAAAAATTATAAAGG + Intergenic
1130139325 15:81210576-81210598 AAGAAAATGAATAACGAAGAAGG - Intronic
1130419319 15:83727581-83727603 AAGGAAATTAAAAATGAAAATGG - Intronic
1130883196 15:88072536-88072558 AAGCAGTTAAAAAATAAAGAAGG - Intronic
1131418712 15:92284996-92285018 AAGTAGAAGAAAACTGAAGGAGG - Intergenic
1131580397 15:93637248-93637270 GAGGAGGAGAAAAAAGAAGAGGG - Intergenic
1131608540 15:93935680-93935702 GAGGAGGTGAAAAATGTCGATGG - Intergenic
1131611289 15:93967063-93967085 AAGGATATAAAAATTGAAGTAGG - Intergenic
1131747535 15:95465319-95465341 AAGTAGTTGAAAAAAGATGATGG - Intergenic
1131875234 15:96798895-96798917 AATGAGATGAAAAAGGGATAGGG - Intergenic
1131895554 15:97025333-97025355 AAGGAGATAAAAAATAAAACAGG - Intergenic
1202972726 15_KI270727v1_random:255234-255256 AGAGAGATGAAAACTGAAGGGGG - Intergenic
1132540856 16:508795-508817 AAGGAGAGGAAACATCCAGAAGG - Intronic
1133210856 16:4262738-4262760 CTGGAGATGAATGATGAAGAGGG - Intronic
1133572359 16:7054072-7054094 ACAGAGAACAAAAATGAAGAGGG - Intronic
1133611774 16:7440372-7440394 AAGGAGGTAGAAAATGAATATGG + Intronic
1133624552 16:7558862-7558884 AAGCATCTGAAAAATGTAGATGG + Intronic
1133630236 16:7613538-7613560 ATGAAGTTTAAAAATGAAGAGGG + Intronic
1134590587 16:15449844-15449866 ATGGAGATTAAAAATAAAGTAGG - Intronic
1134649573 16:15898111-15898133 AAGAAGATGAAAGAGGAGGAGGG - Intergenic
1134765368 16:16752730-16752752 AAACAGCTAAAAAATGAAGAAGG - Intergenic
1134799661 16:17071889-17071911 AGGGAGGTAAAAAAGGAAGAAGG - Intergenic
1134800166 16:17076945-17076967 AAGGAGATGAGTAAGGAAAATGG - Intergenic
1134892584 16:17854062-17854084 AAGGAGATGGAAGATGAGGGAGG + Intergenic
1134980688 16:18606481-18606503 AAACAGCTAAAAAATGAAGAAGG + Intergenic
1135334591 16:21590325-21590347 AGGGAGATGAAAACTGTAGCGGG + Intergenic
1135476313 16:22779003-22779025 AAGGAAATGAAAACTGAGTAAGG + Intergenic
1135769891 16:25209621-25209643 AAAGAGATAGAAAAGGAAGACGG + Intergenic
1135833767 16:25804287-25804309 ATGCAGAAGAAAAATGAAAAAGG - Intronic
1136094771 16:27947335-27947357 AAGGAGAAGAAAGAAGAAGAAGG + Intronic
1136351686 16:29712930-29712952 AAGGACATGAAACAAGATGAAGG - Intergenic
1136491885 16:30613939-30613961 AAGGAGAAGAAAGAAGAAGGAGG + Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136958521 16:34815590-34815612 CAGGAAATAGAAAATGAAGAAGG - Intergenic
1137577424 16:49609730-49609752 AAGGAGATAAAAAAAAAAGAGGG + Intronic
1138148534 16:54634271-54634293 AAGGCAATGAACAATGAAAAGGG + Intergenic
1138301939 16:55937735-55937757 AAAGAGAAGAATTATGAAGAAGG - Intronic
1138395122 16:56698174-56698196 AAGGTGATGATATATGGAGATGG - Intronic
1138657017 16:58497331-58497353 AAGAAGAAGAAAAAAAAAGAGGG + Intronic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139167552 16:64585954-64585976 ATGGAGACAAAAGATGAAGAAGG - Intergenic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1140541984 16:75764638-75764660 AAGAAGACAAAGAATGAAGATGG + Intergenic
1140657040 16:77151687-77151709 AAGGAGAGGAAAAATGAGAATGG - Intergenic
1140958168 16:79886931-79886953 AAAAAGAAGAAAAAAGAAGAAGG - Intergenic
1140999523 16:80295506-80295528 TTAGAGTTGAAAAATGAAGATGG - Intergenic
1141325569 16:83055446-83055468 AAGAATAAGAAAAAAGAAGAAGG + Intronic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141460362 16:84175356-84175378 AAGGAAATGAAAACAGGAGAGGG + Intronic
1141782075 16:86169234-86169256 AAGGGGATGAGAAGTGAGGAGGG + Intergenic
1142493089 17:291080-291102 GTGGAGATGAACACTGAAGATGG + Intronic
1142923299 17:3210141-3210163 ATGGAAAAGAAAAAAGAAGACGG - Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143035134 17:3990789-3990811 AATGAGAAGAAAGAAGAAGAAGG - Intergenic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143733524 17:8894685-8894707 AAGGAGATGAAACAGAAAGCGGG + Intronic
1144052749 17:11511042-11511064 AATGAGATGACATATGAACAGGG + Intronic
1144244743 17:13351947-13351969 AAGGAGAAGTAAAAGGAAAAGGG - Intergenic
1144295605 17:13872290-13872312 AAAGAAATGAGAAATGGAGATGG + Intergenic
1144365176 17:14536856-14536878 AAGGATATGAAAAATTCACATGG - Intergenic
1144713171 17:17416228-17416250 AATGAGATGAAAGAAGAAGGTGG - Intergenic
1144814235 17:18022171-18022193 AAAGAGATGTAAAAGGCAGATGG - Intronic
1145854885 17:28145640-28145662 AAGGATATCATCAATGAAGAAGG - Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146424695 17:32725614-32725636 AAAAAGATGGAAAATAAAGATGG + Intronic
1146490618 17:33278893-33278915 AAGGAGATGACAGCTGAGGAAGG + Intronic
1146643487 17:34559477-34559499 AAGGGGATTAAAAATCAACAAGG + Intergenic
1146701249 17:34962075-34962097 AAGGAGATGGAGAAAGAAAAAGG + Exonic
1147049090 17:37777615-37777637 AAAGAGAGCAAAAATGAAGAAGG - Intergenic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147661966 17:42121518-42121540 AAAGAGATTACAAGTGAAGAGGG - Exonic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1148136596 17:45296537-45296559 AAGGAGGGGAAAAAAAAAGAGGG + Intronic
1148170042 17:45511405-45511427 AAGGAAAGGAAAAAGGAAAAGGG + Intergenic
1148279165 17:46334411-46334433 AAGGAAAGGAAAAAGGAAAAGGG - Intronic
1148301382 17:46552264-46552286 AAGGAAAGGAAAAAGGAAAAGGG - Intronic
1148507639 17:48140749-48140771 AAGAAGAAGAAAGAAGAAGAAGG - Intronic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149397817 17:56262731-56262753 AATGAGATAATAAATGAGGATGG + Intronic
1149665784 17:58363998-58364020 AAGGAGAAGAGAGAGGAAGAAGG + Intronic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150152242 17:62819584-62819606 AAGGAGAGGAAGGATGGAGAGGG - Intergenic
1150173571 17:63025361-63025383 AAAGATAGTAAAAATGAAGAAGG - Intronic
1150401123 17:64857001-64857023 AAGGAAAGGAAAAAGGAAAAGGG + Intronic
1151041866 17:70871993-70872015 AAACAGATGCAAAATGAATAAGG + Intergenic
1151171899 17:72253645-72253667 CAGGACATGAAAAGAGAAGAGGG - Intergenic
1151638371 17:75369397-75369419 AAAGATATGAAAATTTAAGAAGG + Intronic
1152053895 17:78006609-78006631 AAGAAGAAGAAAGAAGAAGAAGG - Intronic
1152731675 17:81975113-81975135 AAGGAGAAGAAAGAAGAAGAGGG - Intergenic
1153325549 18:3815736-3815758 CACGTCATGAAAAATGAAGAAGG - Intronic
1153394428 18:4602445-4602467 AACATGATGGAAAATGAAGATGG - Intergenic
1153499737 18:5736329-5736351 AAAGCAAAGAAAAATGAAGACGG - Intergenic
1153544966 18:6195970-6195992 GAGGGGATGAGGAATGAAGAGGG - Intronic
1153678123 18:7473914-7473936 AATGACAGGAAAAATGGAGATGG - Intergenic
1153850954 18:9093815-9093837 AAGGAGGAGAAAGAAGAAGAAGG - Intergenic
1153955253 18:10090645-10090667 AAGGAGAAGGAAGAAGAAGAGGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154082579 18:11273010-11273032 AGGGTGATGAAAAATGAAGCTGG + Intergenic
1154409489 18:14129778-14129800 AAGTAGTTGAGAAATAAAGATGG - Intronic
1154935214 18:21047828-21047850 AAGGATATGAAAAATGTTGAAGG - Intronic
1155058598 18:22207606-22207628 AAAGAAATGAAAGAAGAAGAAGG - Intergenic
1155314066 18:24553690-24553712 AAGGTTATGAAAACTGAACAAGG - Intergenic
1155331315 18:24721215-24721237 AAGAAGAGGAAACTTGAAGATGG - Intergenic
1155332183 18:24729653-24729675 TTTGAGATGAAAGATGAAGAAGG - Intergenic
1155372915 18:25122143-25122165 GAAGAGATGAAAAATACAGATGG + Intronic
1155538980 18:26847183-26847205 AAAGAGAGGAAAAGAGAAGAGGG - Intergenic
1156124304 18:33884593-33884615 AAAAAGATGAAGAATGCAGAAGG - Intronic
1156312459 18:35937303-35937325 AGAGAGATGAAAAAGGAGGAGGG + Intergenic
1156592083 18:38501821-38501843 AAGGAAGTGAAAAAGGAGGAAGG + Intergenic
1156723819 18:40103350-40103372 AAAGAAATGAAAAAAGAAGAAGG - Intergenic
1156741117 18:40329674-40329696 TATAAGATGAAAAATGATGATGG - Intergenic
1156948111 18:42859952-42859974 AAGGAAATGAAATGTGTAGAGGG - Intronic
1157049902 18:44151415-44151437 AAGGTGACAAAAATTGAAGATGG + Intergenic
1157261853 18:46182402-46182424 AAGGAGATAGAAAATGACCAGGG + Intronic
1157353582 18:46913530-46913552 AAGGGGATGAAGAATACAGAAGG + Intronic
1157447803 18:47758923-47758945 AAGGAGATGAAAAACACATAAGG + Intergenic
1157511201 18:48276188-48276210 AATGAGAAGAGGAATGAAGAGGG - Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1157771664 18:50353110-50353132 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1157813402 18:50714042-50714064 AAGCAGATGAAAAGTTAAGAAGG - Intronic
1157955013 18:52087071-52087093 AAGCAGATGAATATTGATGAAGG + Intergenic
1158112532 18:53956738-53956760 ATGGAGATCAACAGTGAAGAAGG + Intergenic
1158744360 18:60181483-60181505 ACAGAGATGAAAAATGGTGAAGG - Intergenic
1159012511 18:63071364-63071386 AAGCAGCTGAAAAATCAACATGG - Intergenic
1159115316 18:64106737-64106759 AAGGAGCAGAAAAATGACGCAGG + Intergenic
1159162055 18:64655137-64655159 AATGAGCTGGTAAATGAAGATGG - Intergenic
1159271236 18:66153804-66153826 AAGAAGAAGAAAGACGAAGAAGG + Intergenic
1159284612 18:66333341-66333363 AAAAAAATGAAAAATGATGAAGG - Intergenic
1159457473 18:68678927-68678949 AAGGAGAGAAAAAGGGAAGAAGG + Intronic
1159591007 18:70335046-70335068 AAGAAGAAGAAAGATGAAGAAGG - Intergenic
1159688364 18:71453000-71453022 AAAGAGAAAATAAATGAAGAAGG + Intergenic
1159779164 18:72641647-72641669 AAGGACATGAAGAATGGTGATGG - Intergenic
1159850340 18:73519906-73519928 AAGCAGATGACAAATGAGGTAGG - Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160118619 18:76106786-76106808 AAGGAAATTATAAATGAAGGAGG - Intergenic
1162639094 19:11993714-11993736 ATGGAGATCAAGAGTGAAGAGGG + Intergenic
1162731883 19:12723154-12723176 AAGGAGATGAAAAAGCCACAAGG + Intronic
1162832247 19:13292692-13292714 AAGAAGAGGAAAAATGTACAAGG + Intronic
1163192835 19:15691512-15691534 TAAAAGATGAAATATGAAGATGG - Intronic
1163468640 19:17484284-17484306 AAGGAGATAATAAATAAGGATGG + Intronic
1164292222 19:23879072-23879094 AAGAGGAGGAAAAATGAAGGAGG + Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1164710172 19:30351031-30351053 AAGAAGTGGAAAAATAAAGACGG + Intronic
1165164873 19:33845452-33845474 AAGGAGATACACAATGAAGTGGG + Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165666338 19:37632153-37632175 AAACAAATGAAAAATTAAGACGG - Exonic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1166195623 19:41203808-41203830 AAGGAGAAGAAAGATGCAGGGGG - Intronic
1166347660 19:42176596-42176618 AGGGAGAGGAAAAAGGGAGAAGG - Intronic
1166381866 19:42358949-42358971 AAGGAGGTGAGATTTGAAGAGGG + Exonic
1166793004 19:45408950-45408972 AAGAAGAGGAAAAAAGAAAAGGG + Exonic
1167073696 19:47235999-47236021 AGGAAGAAGAAAAAAGAAGAAGG - Intergenic
1167219599 19:48189904-48189926 AAGAAGATGAAAATAGAAGGTGG + Intronic
1167581021 19:50342870-50342892 AAGGAGAAGAGAAGAGAAGAGGG + Intronic
1167749430 19:51370944-51370966 CGGGGGATGGAAAATGAAGAGGG - Intergenic
1168303086 19:55418062-55418084 AAGGAGATGCAAATAAAAGATGG - Intergenic
925149870 2:1607560-1607582 AAGGACAGGAAAGATGAGGATGG + Intergenic
925378958 2:3410357-3410379 AAAGAAATGAATAATTAAGATGG + Intronic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925541304 2:4970611-4970633 AAGTGGGAGAAAAATGAAGAGGG - Intergenic
925562821 2:5216544-5216566 GAGGAGGAGAAAAAGGAAGAGGG - Intergenic
925625920 2:5842035-5842057 AAGGAGAAAAGAAAAGAAGAGGG + Intergenic
925683492 2:6447817-6447839 AAGAATGTGAAAGATGAAGAAGG + Intergenic
925697751 2:6599137-6599159 AAGAAGAAGAAAAAGAAAGAAGG + Intergenic
925930986 2:8707760-8707782 AAGGAGATGAAAAAGAATGAGGG - Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926076573 2:9947960-9947982 AAAGAACTTAAAAATGAAGAGGG + Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926157677 2:10466496-10466518 AAGGAGATGAAAGCTCAAGGAGG + Intergenic
926406974 2:12563925-12563947 AAGGAAAAGAAAAAAGGAGAAGG + Intergenic
926882769 2:17566461-17566483 AAGAAAATGAAAAATTATGAAGG - Intronic
927387557 2:22552883-22552905 AAGCAGATGAAAATCAAAGATGG + Intergenic
927396039 2:22652436-22652458 AAAGCAAAGAAAAATGAAGAAGG + Intergenic
927444347 2:23144596-23144618 AAGGCAATGGAAAATGAACAGGG + Intergenic
927468009 2:23351373-23351395 AAGGACCTGAGAAATGTAGAAGG - Intergenic
928109036 2:28491662-28491684 AAGAAGAGATAAAATGAAGAAGG - Intronic
928250031 2:29668136-29668158 AATGAAATTAGAAATGAAGAGGG - Intronic
928335249 2:30392447-30392469 AAGGAAAATAAAAAGGAAGAGGG + Intergenic
929183660 2:39070400-39070422 AAGGACATGGAAAAGGAATAAGG - Intronic
929844867 2:45513521-45513543 AAGAAGATGAAAAATTCAAAAGG + Intronic
929920911 2:46171002-46171024 AAGTAGATGATAAATGAAAAAGG + Intronic
929975991 2:46635352-46635374 AAGGACTTGAAAAATGCAGTGGG - Intergenic
930068329 2:47344999-47345021 AAGGAAATGAAAAAAAAAAAGGG + Intergenic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930778322 2:55197120-55197142 AAGGAGAGGAAAAAATAGGAAGG + Intronic
930869431 2:56154846-56154868 AAGGTGATGAAAACAGAACATGG - Intergenic
931201632 2:60103284-60103306 AAGGAGGAGAGAAGTGAAGAGGG + Intergenic
931388776 2:61821388-61821410 AAGGAGATAAAAAATTGAGAAGG - Intergenic
931511592 2:63001814-63001836 AAGAAGATGAGAGATGAAGCAGG - Intronic
932098853 2:68878010-68878032 AAGAAGAAGAAAAAAGAAAAGGG - Intergenic
932111300 2:69003579-69003601 AAGGATGGGAAAAAGGAAGAGGG - Intergenic
932973087 2:76569812-76569834 AAGTAAATTAAAAATGAAAAAGG - Intergenic
933096739 2:78192904-78192926 AAGGAGAAGAAAAAGAAAAAGGG + Intergenic
933335377 2:80951226-80951248 ATGGAGATGAAAAATGAAGCTGG - Intergenic
933359372 2:81259196-81259218 AAGAATGTGAAAAATGAAGTTGG + Intergenic
933535211 2:83563912-83563934 AAAGAGAAAAAAAATGAATAGGG + Intergenic
933569725 2:83995427-83995449 AAGGAAAGGAAAAAGGAAGAAGG - Intergenic
934092740 2:88567446-88567468 AAGAACATGGAAAATAAAGATGG - Intronic
934924179 2:98370214-98370236 AGTGAGATGAAAAATGAAGTTGG - Intronic
934929172 2:98406090-98406112 CTGGAGATGAAAAATGCAAATGG + Intergenic
935098924 2:99973680-99973702 AAGGAAAAAAAAACTGAAGATGG - Intronic
935111864 2:100101828-100101850 AAAGATAGGAAAATTGAAGATGG - Intronic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
935537858 2:104315103-104315125 AAGCAGGTGAAAATTGAATAAGG + Intergenic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
936221580 2:110608139-110608161 AAAGATAGGAAAATTGAAGATGG - Intergenic
936235456 2:110738823-110738845 AAAGAGATGGAAAATAAAAAAGG - Intronic
936249124 2:110853846-110853868 AAGGAGAGGAGAGAGGAAGATGG - Intronic
936379554 2:111972338-111972360 GAGGACATGAAACATGAGGATGG + Intronic
936654480 2:114468961-114468983 AAGGAAAAGACAAATGAAAATGG + Intronic
936731298 2:115384525-115384547 AAGAAGAAGAAAGAAGAAGAAGG + Intronic
936874675 2:117173955-117173977 TAGAAGATGGAACATGAAGAAGG + Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937070773 2:119061360-119061382 AAGGAAAAGAAAGATGAAAAGGG - Intergenic
937992357 2:127671733-127671755 AAGTAGAAGAAAAAGGAAGGAGG + Intronic
938675702 2:133631828-133631850 TAGTAAATGAAAACTGAAGAGGG + Intergenic
938997936 2:136700601-136700623 AGGGACATGGAAAATGAAGCTGG + Intergenic
939106833 2:137958677-137958699 CAGAAGAAGAAAAATGAAAAAGG + Intergenic
939207077 2:139120478-139120500 TAGTAGATTAAAAATGGAGATGG - Intergenic
939269541 2:139920232-139920254 AAGGAAAAAAAAAAAGAAGAGGG - Intergenic
939315821 2:140548442-140548464 ATGGAGATGAAATAAGAAGATGG - Intronic
939367295 2:141250025-141250047 AAGAAACAGAAAAATGAAGAGGG + Intronic
939374904 2:141351841-141351863 AGCTAGAAGAAAAATGAAGATGG + Intronic
939390535 2:141563517-141563539 AAGGAGAGGATAAAAGAAGAGGG + Intronic
939854071 2:147336030-147336052 GGGGAGATAAAAAATAAAGAAGG - Intergenic
939926570 2:148182013-148182035 AAGGAGTTTAAATATAAAGATGG - Intronic
940086250 2:149862339-149862361 AAGGAGGTTAAAAATGGAGGAGG + Intergenic
940678831 2:156758216-156758238 AAAGAAATGAGAAATTAAGATGG - Intergenic
940721617 2:157288769-157288791 AGGAAGATGAAAAAGGAAGTAGG + Intronic
940742872 2:157531489-157531511 AATGACAAGAAAAATGGAGATGG + Exonic
941242214 2:163053555-163053577 AAGGAGGAGAAAGATGAAGAAGG + Intergenic
941281920 2:163562552-163562574 AAGGAGAGGAACATTGGAGAAGG + Intergenic
941345424 2:164362521-164362543 AAGGAGAGGAAAAATGTATGGGG - Intergenic
941919296 2:170833112-170833134 AATGAGAGGGAAAATAAAGAAGG - Intronic
941973596 2:171379545-171379567 AAATAGATGAAAAATGATAAAGG + Intronic
942567841 2:177284445-177284467 AAGGAAAGGAAACATTAAGATGG - Intronic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943049425 2:182897042-182897064 AAGGAGCTGAAAATGGAAGCAGG - Intergenic
943078082 2:183222541-183222563 CAGGAGATGAATAATGATGCTGG - Intergenic
943485404 2:188473497-188473519 AAGGGGATGAAAGATTGAGAAGG - Intronic
943562431 2:189479815-189479837 AATGAAATGAACAATGAGGAAGG - Intergenic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944099137 2:196003761-196003783 AAGGAGATTAAAATGGAATAAGG - Intronic
944300731 2:198121862-198121884 AAGGAGGAGAAAAATAAAGATGG - Intronic
944996581 2:205301589-205301611 AAGGAGAAGAAAAAGGAAAAGGG + Exonic
945053199 2:205845003-205845025 AAGCAGAAGAAAAAGAAAGAAGG + Intergenic
945299911 2:208206493-208206515 AAGGAGATGGACGAGGAAGATGG + Intergenic
945428287 2:209734900-209734922 AAGGAGCTAAAAGATGAACAGGG - Intergenic
945499390 2:210551650-210551672 AAGAAGGTGAAAAATGAAGCTGG - Intronic
945535617 2:211014198-211014220 AAGGAGATTAAAACTGTAAATGG + Intergenic
945804305 2:214471419-214471441 AATGAGATTAAAAATGTAAAAGG + Intronic
945869731 2:215214122-215214144 AATTCCATGAAAAATGAAGAGGG + Intergenic
945904089 2:215571097-215571119 AAAGGGTTGAAAGATGAAGAGGG - Intergenic
946037030 2:216752387-216752409 AAGAAGATGGAAAATGACCATGG - Intergenic
946051630 2:216867603-216867625 AAGGAGAAGGAAGAGGAAGAGGG - Intergenic
946101027 2:217323239-217323261 AATGAGAAGTAAAAAGAAGACGG - Intronic
946141778 2:217697363-217697385 AGGGAGAAGAAAAGAGAAGATGG - Intronic
946474735 2:219996322-219996344 TAGGAGGTGAAAAATGAAGGTGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946743228 2:222820428-222820450 AAGGAGAGGCAAGATGAAAAAGG - Intergenic
946806441 2:223475394-223475416 AAAGAAAAGAAAAATGGAGAAGG - Intergenic
947106468 2:226673095-226673117 AGGGAGAAAAAAAATGAAAAGGG - Intergenic
947182919 2:227428068-227428090 AAAGAGAAGAGAAAAGAAGAAGG - Intergenic
947240465 2:227988999-227989021 AAGGGTATGAAAAATGAATTAGG + Intronic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947268521 2:228307597-228307619 ATGGAGATGAAAACAGTAGAGGG + Intergenic
947292106 2:228587140-228587162 ATGGAGATGAAATATGGAGAAGG - Intergenic
947391673 2:229645637-229645659 AAGGAGATGAACCAGGAACATGG + Intronic
947701185 2:232235548-232235570 CAGGAGATAAAATATGAAGAAGG - Intronic
947981996 2:234418535-234418557 AATGAGATGAAGAAAGAAGCAGG - Intergenic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
1168798714 20:630075-630097 GAGGAGAGGAAAGAAGAAGAAGG + Intergenic
1168910065 20:1440485-1440507 AGAGAGAAGAAAAATGAAGCAGG + Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169368990 20:5014135-5014157 AAGAAGATAAAGGATGAAGAAGG + Intergenic
1169600844 20:7259065-7259087 AAGGAGAGGGAAAAAGGAGAAGG - Intergenic
1169898640 20:10531252-10531274 TGGGAGATTAAAAATGTAGATGG + Intronic
1170333378 20:15240574-15240596 AAGAAGAAGAAAAAGGAAAATGG + Intronic
1170686219 20:18571852-18571874 AAGGAGAAGGAACAAGAAGAGGG - Intronic
1171045324 20:21805161-21805183 AAGGAGAGTAAAAAAGAAGCAGG - Intergenic
1171077466 20:22143106-22143128 AAGAAGAGGAAAAGTGAAGGAGG - Intergenic
1171377846 20:24706411-24706433 AAGGAGAGGAATAATAAATAGGG - Intergenic
1171496451 20:25559546-25559568 AAGCAGACGGAAAATGAAAAAGG - Intronic
1171751402 20:29053227-29053249 AAGGAGTTCAAAAAATAAGAAGG - Intergenic
1171790928 20:29524653-29524675 AAGGAGTTCAAAAAATAAGAAGG + Intergenic
1171856777 20:30352180-30352202 AAGGAGTTCAAAAAATAAGAAGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172206975 20:33169731-33169753 AAATATATGAAAAAAGAAGAGGG - Intronic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1172827299 20:37800373-37800395 AAGGAGGTGAGAAAGTAAGAAGG - Intronic
1172831903 20:37843038-37843060 AAGGAGGTGAAAAACACAGAGGG - Intronic
1172891398 20:38268475-38268497 AAGGAGAGGGGGAATGAAGAAGG - Intronic
1173046813 20:39520647-39520669 GAGGAGATGACAAAAGAAGCTGG - Intergenic
1173192190 20:40885310-40885332 AATGACATGAAAAACCAAGAGGG + Intergenic
1173438894 20:43057458-43057480 AAGGAAAGGAAAAAGGAAAAGGG + Intronic
1173634653 20:44544652-44544674 AATGAGATGTAAACTGAACATGG - Intronic
1173936673 20:46872055-46872077 AAGGTCATGAAAAACAAAGAAGG + Intergenic
1173965248 20:47107757-47107779 AAGGAGAAGAAAGAAGAAGTAGG + Intronic
1174004305 20:47398255-47398277 AAGGAGAAGGGAAAGGAAGAGGG + Intergenic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1175398243 20:58682645-58682667 AAAGAAATGAAAAATTAAAATGG - Intronic
1175450338 20:59060375-59060397 AAGGAGAGAAAAAATAAATATGG + Intergenic
1175544694 20:59770815-59770837 AAGGAGAGGTAAAAGGGAGAGGG - Intronic
1175587497 20:60154895-60154917 AAAGAGGAGAAAAAGGAAGAAGG - Intergenic
1176313372 21:5217714-5217736 AAGGAGTTCAAAAAATAAGAAGG + Intergenic
1176672594 21:9748535-9748557 GAGGTGATGAAAATTGGAGAAGG + Intergenic
1176700131 21:10037264-10037286 AAGGAAATGACAAATGTACAAGG - Intergenic
1177028151 21:15948216-15948238 AAGGAGATAACAAATGGATAAGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177332050 21:19677740-19677762 AATGTGATGAAAAATTAACAAGG - Intergenic
1177714446 21:24821175-24821197 AAAGAGAAGAAAAATGGATATGG - Intergenic
1177743915 21:25187636-25187658 AGGGAGTTGAAAAAGGAAAAAGG + Intergenic
1178057858 21:28819524-28819546 AAGGAAAAGAAAAATAAAGGTGG - Intergenic
1178237032 21:30854898-30854920 AAGTAGAACAAAAATAAAGAAGG + Intergenic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178399781 21:32275615-32275637 AGGGTGAAGAGAAATGAAGAAGG + Intronic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179642049 21:42754153-42754175 AAGAAGAGGAAAAAGCAAGAAGG - Intronic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1181119888 22:20658548-20658570 AAGGAGGGGAAAAAAGACGATGG + Intergenic
1181497947 22:23298577-23298599 AAGGAAAGGAAAAAGGAAAAAGG - Intronic
1181856993 22:25789038-25789060 AAAGAGAAGAAAAAGAAAGAAGG - Intronic
1182685135 22:32116584-32116606 AAAGGGATGAAAAGTGAAGATGG - Intergenic
1182900311 22:33892960-33892982 AAGGGGATTAAAAAGGGAGAAGG + Intronic
1182902087 22:33906994-33907016 AAGCAGAAGAAAAAGGAAAATGG + Intronic
1182966196 22:34523454-34523476 GAGGAGATGAAATTTTAAGAAGG - Intergenic
1182973911 22:34604435-34604457 CAGGAAATGAAGAAAGAAGATGG + Intergenic
1183141466 22:35945018-35945040 AAGGGGAAGAATAATGAAAATGG + Intronic
1183356155 22:37360851-37360873 ATGGAGATGAAGAACCAAGATGG + Intergenic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184433988 22:44458916-44458938 AAGGATATGTAGGATGAAGATGG - Intergenic
1184984030 22:48117284-48117306 AAGGAGAAGGGAAATGAAGGAGG + Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
949167263 3:957816-957838 AAGGAGAGTAGACATGAAGAGGG + Intergenic
949250077 3:1973130-1973152 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
949366256 3:3284828-3284850 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
949468910 3:4373232-4373254 AAAGAGAAAAAAAATCAAGATGG + Intronic
949997647 3:9631137-9631159 AAGGAGTTGGCTAATGAAGATGG + Intergenic
951115217 3:18853261-18853283 AAGGAGAAAAAAAAAAAAGAGGG + Intergenic
951269225 3:20604290-20604312 AGGGAGACTAGAAATGAAGAAGG + Intergenic
951305551 3:21056519-21056541 AAGAAAATGAAAAATGAGGAGGG + Intergenic
951789594 3:26465322-26465344 ATGGAGCTGAAAAATGCAGCAGG + Intergenic
951911652 3:27756214-27756236 ACGGAGATGAAAGAGGAGGAAGG + Intergenic
951962577 3:28345891-28345913 AAGATGATGAAATATGAAAATGG - Intronic
952238835 3:31508994-31509016 AAAGAAATGAAGCATGAAGATGG + Intergenic
952474441 3:33692225-33692247 AAGTAAATGGAAAATGGAGATGG - Intronic
952658579 3:35817653-35817675 AAGGAGAAAAAAAATCAACATGG - Intergenic
953191373 3:40691042-40691064 AAGTAGATGAAAAAGGAGGTGGG + Intergenic
953467459 3:43135615-43135637 AAATAGATGAAAATTGAAAAAGG - Intergenic
953501209 3:43436464-43436486 AAGGAGAAGAACAGTGAAGGTGG + Intronic
954078682 3:48199651-48199673 AAAGAGGTTAAAGATGAAGAGGG - Intergenic
954326659 3:49867809-49867831 AAGGAGATGACAAAGTAAAAGGG + Intronic
955091389 3:55754313-55754335 AAGCAGATGTAAATTGGAGAGGG + Intronic
955287131 3:57653174-57653196 AAGCAAAGGAAAAATGAAAAAGG + Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955595057 3:60580499-60580521 AATGAGATGAAATATTAAAATGG - Intronic
955821700 3:62902665-62902687 ATGAAGATCAATAATGAAGAAGG - Intergenic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956035854 3:65090846-65090868 AAGGAGGAAAAAAATGTAGAGGG - Intergenic
956106293 3:65822181-65822203 AAGGAGGGGAGAAATGAAAAAGG + Intronic
956259651 3:67324809-67324831 TAGGAAATGGAAAAAGAAGATGG + Intergenic
956265297 3:67389583-67389605 AAGCAAATGAAAAATTTAGATGG - Intronic
956278627 3:67531320-67531342 AAGGATATGAAAAATGATAATGG - Intronic
956834173 3:73082096-73082118 AAAGAAAAGTAAAATGAAGAAGG + Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957282329 3:78169779-78169801 AAGGAGGAGAAAAAAGAAAAAGG - Intergenic
957520400 3:81311590-81311612 AAGGAAAAGAAAAAAGAAAAAGG + Intergenic
957644064 3:82896807-82896829 AAGGACATGAAAGAAGGAGAGGG - Intergenic
957731681 3:84147163-84147185 AAGGAGAGGGAAATGGAAGAGGG - Intergenic
957799835 3:85062885-85062907 CAGCAAATGAAAAATAAAGACGG - Intronic
957892123 3:86373569-86373591 AAAGTGATTAAAAATGAAGTAGG - Intergenic
957940254 3:86994094-86994116 AAGGAGTTAACAAGTGAAGAGGG - Intergenic
958025535 3:88044380-88044402 AAAGTGAACAAAAATGAAGAGGG - Intergenic
958070729 3:88607812-88607834 AAGGAAATAAAAAATAAAAAGGG + Intergenic
958885437 3:99721387-99721409 AAGGAAAGGAAAAAGGAAAAGGG + Intronic
959098220 3:101980528-101980550 AAGGACAGAAAGAATGAAGAAGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959273834 3:104250684-104250706 AAGGAGATTAAAAATAAATGTGG - Intergenic
959338786 3:105100933-105100955 AAGTAGAAGAAAAATGTTGATGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959397605 3:105860637-105860659 AGGGAGAAGAAATATTAAGAAGG - Intronic
959579930 3:107972971-107972993 AAGGAGATTAAACACGATGAAGG + Intergenic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
959969690 3:112395349-112395371 AGGGATAGGAAAAATGAAGCTGG - Intergenic
960118219 3:113919299-113919321 ACAGAAATGAAAACTGAAGATGG + Intronic
960216950 3:115051905-115051927 CAGGAGAGAGAAAATGAAGAGGG + Intronic
960316712 3:116187342-116187364 AAGATGATGAAAAATGAAGATGG + Intronic
960400998 3:117198708-117198730 AAGGAGTTGAAGAAGGAAGAAGG - Intergenic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960707986 3:120499739-120499761 AAGGAGAGTAGATATGAAGAGGG + Intergenic
960862951 3:122169878-122169900 AAGAAGAAGAGAGATGAAGAGGG + Intergenic
961262408 3:125612966-125612988 AAGGGCAAGAACAATGAAGAGGG - Intergenic
961310852 3:125999134-125999156 AATGAGATGGAAAATTAACAAGG + Intergenic
961396644 3:126597913-126597935 AAGGTCATGAAAAATAAGGAAGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961761715 3:129174728-129174750 GAGAAGATACAAAATGAAGATGG - Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
963302188 3:143610894-143610916 AGGGAGGTGAAAAAGAAAGAGGG - Intronic
963698481 3:148593149-148593171 AAGCAGATGGAAAATCAATAAGG + Intergenic
963753487 3:149208144-149208166 AAGGAGGGAAAAAATGTAGAAGG + Intronic
963921271 3:150908214-150908236 AAGGACATAAAAATGGAAGAGGG - Intronic
963957403 3:151270009-151270031 AAGGAGATAAATGATGAAGAAGG + Intronic
964239158 3:154571455-154571477 AAGTAGATGCAACATGTAGAAGG - Intergenic
964404723 3:156337447-156337469 AAGAAGAAGGAAAATGAAAAGGG - Intronic
964535440 3:157716272-157716294 GAGGGGAGGAATAATGAAGATGG + Intergenic
964969118 3:162538521-162538543 AAGGAAATAAAAAATGAAGGAGG - Intergenic
965455333 3:168892743-168892765 AAGGAAATGAAAAAGTAAGCTGG + Intergenic
965714859 3:171591985-171592007 AAGAAGAAGAAAGATGAATATGG + Intergenic
965846117 3:172963963-172963985 ATAGTGATGAAAAAAGAAGAAGG - Intronic
966038283 3:175447420-175447442 TAGGAGATTAAAAATGATCATGG - Intronic
966168247 3:177046691-177046713 AAGGGGAAGAAAAGTGAAGTAGG - Intronic
966238594 3:177729723-177729745 AAAGAAAGGAAAAATAAAGAGGG - Intergenic
966588742 3:181655881-181655903 AAGGAGTTGAAGGAGGAAGAAGG - Intergenic
966675321 3:182579959-182579981 AAGCAGCTAAAAAGTGAAGAAGG - Intergenic
966700165 3:182840688-182840710 AAGGAGGTGAAGAAAGACGAAGG - Intronic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966846871 3:184137542-184137564 AAGGGGGTGAAAAATGGGGAAGG + Intronic
967304151 3:188044498-188044520 AAGGAGGTGAAAGCTGAAGGTGG + Intergenic
967414956 3:189206141-189206163 AAAGAGAAGAAAGATAAAGAAGG - Intronic
967542057 3:190679551-190679573 ATGGAGATGAAAACAGTAGACGG - Intergenic
968022272 3:195403492-195403514 ATCCAGATGAAAGATGAAGATGG + Intronic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
969568940 4:7996687-7996709 AAGGAAATGATAATAGAAGAAGG - Intronic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
970473278 4:16397662-16397684 AATGACATGAAGAATCAAGAGGG - Intergenic
970548794 4:17157815-17157837 ATGGAGATAAAAAATAAACACGG - Intergenic
970713703 4:18895013-18895035 AATGTGATGAAAAAGGGAGAGGG + Intergenic
970814171 4:20134316-20134338 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
971035371 4:22687339-22687361 AATGAGATGAAATATGAATATGG + Intergenic
971063750 4:23003571-23003593 AAGGAGACGAAACATGTAGTAGG - Intergenic
971086606 4:23283680-23283702 AAGGTGATTATAAATGAATATGG - Intergenic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971158286 4:24106344-24106366 TAGAAGATAAGAAATGAAGAGGG + Intergenic
971743310 4:30547480-30547502 AAGGAGAAGAATAATTATGAAGG + Intergenic
971971585 4:33627462-33627484 AGAGAGATGGAATATGAAGAGGG - Intergenic
972030540 4:34451707-34451729 ATGAAGGTGAACAATGAAGAAGG - Intergenic
972215772 4:36895491-36895513 ATGGAGATGAAAACAGTAGAGGG - Intergenic
972263224 4:37432836-37432858 AAGCAAATGAAAAAGGAAGAGGG + Intronic
972299346 4:37770536-37770558 GAGGAGATAAAAGATGTAGAGGG - Intergenic
972574887 4:40342746-40342768 AAGGAGATGAGAGAGGTAGAAGG + Intronic
972908716 4:43785920-43785942 AAGGAGACCGAAAATGAAGCTGG + Intergenic
973029657 4:45320901-45320923 AAGCACATGAAAAATGCAGATGG - Intergenic
973202487 4:47520325-47520347 AATGAGATGAAAAATACAGATGG - Intronic
973899199 4:55450430-55450452 AAAGAGAAGAAGAATGAAGTTGG + Intronic
974247505 4:59339626-59339648 AAGGAGATTAGGAAAGAAGAAGG + Intergenic
974669392 4:65009373-65009395 AAGGAGAGAAAAATTGACGAGGG + Intergenic
974809504 4:66927827-66927849 AAGGAGAAGAAAAAAGAAAAGGG + Intergenic
974935602 4:68406286-68406308 ATGCACATGAAAAATGAAGTGGG + Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975053364 4:69894669-69894691 TAAGAGATGAAAAATGAATATGG + Intergenic
975454294 4:74572058-74572080 AGAGAGATGACAAAAGAAGAAGG + Intergenic
975698679 4:77040643-77040665 ATGGAGCTGAAAAGTAAAGATGG - Intergenic
976258973 4:83127836-83127858 AATGACATGAAAATTGAAAAGGG + Intronic
976299975 4:83508031-83508053 AGGGAGCAGAAAAATGAAGTGGG + Intronic
976323092 4:83738162-83738184 TAGAAAATGAATAATGAAGACGG + Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976777192 4:88719621-88719643 AAGGAGAAGAAAGAAGGAGAAGG - Intergenic
976777200 4:88719676-88719698 AAGGAGAAGAAAAAAGGAGGAGG - Intergenic
976965074 4:91027984-91028006 ATGGAAAAGAAAAAAGAAGAGGG + Intronic
977305230 4:95316298-95316320 AAGGAAATAATAAATAAAGATGG + Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977767506 4:100817293-100817315 AAATAGGTGAAAAATGAAAAGGG - Intronic
977854865 4:101876879-101876901 CTGGAGCTGAAAAATGAAGTTGG + Intronic
977866429 4:102033853-102033875 AAGGAAATAAAAAATGGAAAAGG - Intronic
977927059 4:102713298-102713320 AGGGAAATGAAGGATGAAGATGG - Intronic
978011661 4:103693078-103693100 AAGGAAATGAAAAATGAACCAGG - Intronic
978021240 4:103815487-103815509 AAGGAGAAGAAAAAAGAGAAGGG - Intergenic
978121641 4:105086555-105086577 AATGAAATTAAAAATGATGAAGG - Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978421077 4:108533427-108533449 AAGGAGAGGGAAAAGGAAAAGGG - Intergenic
978914619 4:114109225-114109247 AAGCAGATGAAAAATTGAAAAGG - Intergenic
978926278 4:114249542-114249564 AAGCAGATGATAAAGGCAGAAGG + Intergenic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
979197699 4:117940624-117940646 ATGGAGCTGAAAAATGCAGCAGG - Intergenic
979541629 4:121890334-121890356 AAAGAAATGATAAATGAACAAGG + Intronic
979582460 4:122376959-122376981 TAGGTCATGAAAAATAAAGAAGG + Intergenic
980019313 4:127689673-127689695 AAGGAAAAGGAAAAAGAAGAGGG + Intronic
980141482 4:128922912-128922934 AAAAAGATGAAAAATAAAGAGGG + Intronic
980372532 4:131895910-131895932 AAGGAAATGACAAATGTACAAGG - Intergenic
980657736 4:135811741-135811763 AAGGAGAGGAAAGATTAGGAAGG + Intergenic
981157490 4:141456709-141456731 AAGGAGAGCAATAATGAAGCAGG - Intergenic
981239145 4:142454118-142454140 AAGAAGATGGGAAAGGAAGAAGG - Intronic
981358961 4:143825654-143825676 AAGGAGAAGGAAAACGAAGTTGG + Intergenic
981379479 4:144056498-144056520 AAGGAGAAGGAAAAGGAAGTTGG + Intergenic
981556973 4:146005728-146005750 AATGAAATAAAAAATGAAAAAGG - Intergenic
981562598 4:146063931-146063953 AAGGAAATGAGGAAGGAAGAAGG - Intergenic
981604121 4:146524099-146524121 AAGGAGGTGCAACGTGAAGATGG - Intergenic
981676268 4:147346590-147346612 ATGCAGATGAAAAATTAAAATGG + Intergenic
982250384 4:153400207-153400229 ATGGTGATGAAAAATGATAAAGG - Intronic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982308899 4:153963284-153963306 AAGGAGAGGAACAATGAAAGAGG - Intergenic
982347353 4:154374788-154374810 AAGCAGATGAAAAAGAAACAAGG + Intronic
982406708 4:155028714-155028736 AAGAAGAGGAAAAAGGAAGATGG - Intergenic
982420566 4:155191643-155191665 AAGGATTTGAAAGATGAATAAGG - Intergenic
982718100 4:158830097-158830119 AAGCAGATTATAAATGAAGGAGG + Intronic
982920134 4:161263660-161263682 GTGGAGATGAAAAATGAAATCGG - Intergenic
983069477 4:163252062-163252084 AAGGGAATGATAAATGGAGAGGG + Intergenic
983080385 4:163377943-163377965 AAGTAGATGAATGAAGAAGAGGG - Intergenic
983225600 4:165083153-165083175 AACAAGATGAAATATGAAAAGGG + Intronic
983301810 4:165935128-165935150 AAGGAGATGGAAAATCAGAAAGG + Intronic
983409331 4:167376954-167376976 AAAGATATGGAAAATAAAGATGG + Intergenic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983449388 4:167891536-167891558 AAGGAGAGGAAAAAAGAGGTGGG + Intergenic
983643504 4:169966252-169966274 GAGAAGATGAAGGATGAAGATGG + Intergenic
983844544 4:172500707-172500729 AAGGAAATGATAACTTAAGACGG + Intronic
983982022 4:174009435-174009457 AGGGAGCTGAAAACTGAATATGG + Intergenic
984025270 4:174535831-174535853 AAAGAAATGAAAAATGCACAAGG + Intergenic
984071299 4:175116576-175116598 ATGGATAGGAAAAATTAAGATGG + Intergenic
984190791 4:176603571-176603593 TAAGAGATGAAAAAATAAGATGG - Intergenic
984407800 4:179355783-179355805 CAAGAGAAGAAAAATGAAGTAGG - Intergenic
984680673 4:182605635-182605657 AATGGGAAGAAACATGAAGAGGG + Intronic
984697605 4:182795098-182795120 AAGCAGATGTGAAATGAACAGGG - Intronic
984899770 4:184575180-184575202 AAGGAAATGATAACAGAAGAAGG + Intergenic
985402130 4:189603296-189603318 GAGGTGATGAAAATTGGAGAAGG - Intergenic
985608948 5:875857-875879 ACAGAGATGAAAGATGAAGATGG + Intronic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
986271933 5:6239253-6239275 AAGAAGATGGAAAAAAAAGAAGG + Intergenic
986348965 5:6859291-6859313 AAGGGGATGAAAAATGCATCAGG - Intergenic
986766031 5:10927422-10927444 AAGGAAAAGAAAACTGAAGTAGG + Intergenic
986820744 5:11464264-11464286 AAGGTGATGAAAAATAAAATAGG + Intronic
987246342 5:16053077-16053099 AAAGGGAAGAAAAAGGAAGAGGG - Intergenic
987447892 5:18043725-18043747 AAAAAGAAAAAAAATGAAGAAGG - Intergenic
987575789 5:19726193-19726215 AAAGAGATGAAAAAGGAAGAAGG + Intronic
987743918 5:21946277-21946299 AAAGAAATGATAAAAGAAGAAGG + Intronic
987982400 5:25103124-25103146 AAGGAGAGGAAAAGAGATGAGGG + Intergenic
988089626 5:26519794-26519816 AAGGAGAAGGAAAAAGAAGAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988299642 5:29405254-29405276 CAGGAGCTGAAAAATGCAGTTGG + Intergenic
988388382 5:30596285-30596307 AAGGAAATGAAAACTAAAAATGG + Intergenic
988456849 5:31394413-31394435 AAGGCTAAGAAAAATGAAGCTGG - Intergenic
988474608 5:31572644-31572666 AAGGAAAACAAAAATGAAGAAGG + Intergenic
988852823 5:35196276-35196298 AAGGAGGTGACAAATGTATATGG + Intronic
989122893 5:38021741-38021763 AAGGAGAATAGAAAGGAAGAAGG - Intergenic
989389429 5:40885121-40885143 AAAAAGATGAAAAAAGAAGCAGG - Intergenic
989406779 5:41070170-41070192 AAGGGTATGGAAAAAGAAGATGG - Intronic
989476487 5:41880240-41880262 GAGGAGATGAAGACTGAACAAGG + Intergenic
989695638 5:44197215-44197237 AAGGAGATAAGAAATTATGATGG + Intergenic
989781329 5:45267933-45267955 AAGGAGTTGAAAAAAGAAAGGGG + Intronic
990438024 5:55813610-55813632 CAGGAAATGAAAAATAAAGCAGG - Intronic
990573888 5:57106356-57106378 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
990600983 5:57358474-57358496 AAGGAGATTAAAATTGATGCAGG + Intergenic
991195328 5:63925298-63925320 AAGAAGATGAAAAATGAAATGGG - Intergenic
991489836 5:67171830-67171852 ACGGAGATTAAATAAGAAGATGG - Intergenic
991511125 5:67377220-67377242 AAGGAGATGACAATTAGAGAAGG + Intergenic
991513071 5:67401547-67401569 AAGGAAAAAAAATATGAAGATGG - Intergenic
991646223 5:68803130-68803152 AAGCAGATGACAAAAGAATATGG + Intergenic
991764118 5:69956416-69956438 AAAGAAATGATAAAAGAAGAAGG + Intergenic
991783207 5:70161731-70161753 AAAGAAATGATAAAAGAAGAAGG - Intergenic
991843350 5:70831488-70831510 AAAGAAATGATAAAAGAAGAAGG + Intergenic
992090687 5:73313148-73313170 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
992193824 5:74320229-74320251 AAGGAGATGAAGAAAAAGGAGGG - Intergenic
992277757 5:75138493-75138515 AAGGAGGAGAAAAGAGAAGAAGG + Intronic
992540585 5:77760379-77760401 AAGGAAAGGAAAAAGGAGGAAGG - Intronic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
993113777 5:83693399-83693421 AAGAAGATAGAAAAAGAAGAGGG + Intronic
993499673 5:88651238-88651260 AAGGTGATGAAACCTGAAGTTGG - Intergenic
993752131 5:91683218-91683240 AAGGAGAAGGAAAATCAAGGAGG - Intergenic
993798049 5:92294910-92294932 TACGTGATGAATAATGAAGATGG - Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
993815371 5:92538154-92538176 AATGAGATGAAGAATAAAGAAGG - Intergenic
993984901 5:94585629-94585651 AACGAGATGGAAAATTAACAAGG + Intronic
994612937 5:102068596-102068618 AAAGACATGAAAAATAAAAATGG - Intergenic
994829681 5:104763393-104763415 AAGAAAATGAAAGATGCAGATGG + Intergenic
995034337 5:107515879-107515901 AAGCAGTTTAAAAATGAACAGGG + Intronic
995037698 5:107553511-107553533 GGGGAGATGTAAAATGGAGATGG - Intronic
995053423 5:107732294-107732316 AAAAAAATAAAAAATGAAGAGGG - Intergenic
995160336 5:108972432-108972454 AAGGAGACTAATAATGAAGATGG - Intronic
995865750 5:116688548-116688570 AATGATATGAAAACTGAAAATGG - Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996125779 5:119724119-119724141 AAGCAGCTGAAAAATCAAGAAGG + Intergenic
996248721 5:121299880-121299902 AAGGAGAGAAAACATAAAGAAGG + Intergenic
996549412 5:124713816-124713838 AAGGAAGTGAAAAAGGAAGTAGG + Intronic
996877622 5:128256976-128256998 TAGAAGATAAAAAATGATGAGGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997246490 5:132354346-132354368 AAGCAGGAGAAAAATGAAGCAGG - Intergenic
997248553 5:132371410-132371432 AAGGGGATGAGAAATGAGAAAGG - Intronic
997486330 5:134234037-134234059 AAGGAGAGGAAAAAGAAAGGGGG - Intergenic
997650920 5:135519682-135519704 AAGTAGATGGTAAAAGAAGAGGG - Intergenic
997790928 5:136761401-136761423 AAGGAGATATAAAAAGAATATGG - Intergenic
997895488 5:137712354-137712376 AAGGGAATGAAGAATAAAGATGG + Intronic
998006416 5:138659865-138659887 AAGTAGATGAGAAAAGGAGAAGG - Intronic
998933959 5:147214614-147214636 AAGAAGATGAAAGAAAAAGAAGG - Intergenic
999252523 5:150190940-150190962 GAGGATATGATCAATGAAGATGG + Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999640652 5:153669438-153669460 CAGGAGATAAAAAATTAAGCAGG + Intronic
999696597 5:154192538-154192560 AAGGAGATGAAAGGTGATCAAGG - Intronic
999762695 5:154714881-154714903 AATGAAATTAAAAATGAAGCCGG + Intronic
1000373997 5:160562475-160562497 ATGGAGATGAAAAGAGAGGAAGG - Intergenic
1000590858 5:163155792-163155814 AATGATATGAAGAATGGAGAGGG + Intergenic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000671186 5:164065175-164065197 AAGGAAATAAGGAATGAAGATGG - Intergenic
1000971180 5:167716308-167716330 CAGGAGATGAAAGCTGAAGTCGG - Intronic
1001625009 5:173124896-173124918 AAGAAGAAGAAAGAAGAAGAAGG - Intronic
1002203724 5:177548086-177548108 AAAGAGAAGAAAAAGGCAGAAGG - Intronic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003001005 6:2333421-2333443 AAAGAGATGCAAAATATAGAAGG + Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003192453 6:3886541-3886563 AAGGAAATGAAGACTCAAGAAGG - Intergenic
1003256309 6:4478033-4478055 AAGGAGAGGAAAAAGGGATAGGG + Intergenic
1003266897 6:4573940-4573962 GAGGAGAGGAAAGAGGAAGAAGG - Intergenic
1003383629 6:5647826-5647848 CAGGAGATGAAAAAAGGAGGAGG - Intronic
1003418586 6:5935755-5935777 AAGGAGCTGAAAGAAGCAGAAGG - Intergenic
1003631860 6:7794620-7794642 AAGGAGAAGAAGAATGTAAAGGG + Intronic
1003728628 6:8794467-8794489 AAGGTTATAAAAAATGAAGTAGG - Intergenic
1003831996 6:10021875-10021897 AAGGCGAGGAAAAAGGGAGAGGG - Intronic
1004199391 6:13533804-13533826 AAGGAGAAGACAGAGGAAGAAGG + Intergenic
1004207148 6:13602291-13602313 AACAAAATGAAAAATGAAGTTGG + Intronic
1004264670 6:14138662-14138684 ATGGAGATGAAGAATAAATATGG - Intergenic
1004548419 6:16622222-16622244 AAGGGGATAAAAACTGATGAGGG + Intronic
1005078876 6:21936763-21936785 AAGGAGACAAAAAATTAAGACGG + Intergenic
1005119203 6:22371482-22371504 ATGGAGATGAAAACAGTAGAGGG - Intergenic
1005122905 6:22410461-22410483 AATGAGATAAAAACTTAAGATGG - Intergenic
1005659453 6:27980892-27980914 CAGAATATGAAAAATGAACATGG - Intergenic
1005864127 6:29926047-29926069 TCCGGGATGAAAAATGAAGAGGG + Intergenic
1005951542 6:30635300-30635322 AAGTAGATGAAAACTGAGGCCGG + Intronic
1006078728 6:31551588-31551610 AAGGAAAAGAAAAAGGAAGCTGG - Intronic
1006709136 6:36050278-36050300 AGGGAGATGAAGACAGAAGAGGG + Intronic
1007326006 6:41060123-41060145 AAGGAGAAGAAAAAAGAGAAGGG - Intronic
1007806938 6:44457545-44457567 AAACAGATGAAAAATCAACATGG + Intergenic
1008041650 6:46807716-46807738 AAGAAGAGGAAAACAGAAGAAGG + Intronic
1008424399 6:51339948-51339970 AAGGAGATTAAAAAAGGAGTGGG + Intergenic
1008445658 6:51587027-51587049 AAGGAGATGAGAAATTTAGTGGG - Intergenic
1008788540 6:55199820-55199842 AAGGAAATGAAAAATATATAAGG + Intronic
1008789039 6:55206669-55206691 AACTAGATCAAAAATAAAGAAGG + Intronic
1008830683 6:55756932-55756954 AAGGACATGAAACAAAAAGACGG - Intronic
1008978689 6:57457917-57457939 AAGAAAATGAACAAGGAAGATGG - Intronic
1008979034 6:57462226-57462248 AAGGAGGTATAAAATGATGAAGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009004412 6:57765185-57765207 AAGAAGATGAAGAGTGATGATGG + Intergenic
1009166824 6:60350876-60350898 AAGAAAATGAACAAGGAAGATGG - Intergenic
1009189632 6:60614502-60614524 AAGGAGATAGAAAAAGAAGCTGG + Intergenic
1009349433 6:62655494-62655516 AATTAATTGAAAAATGAAGAAGG - Intergenic
1009435852 6:63617807-63617829 ATGAAGAGCAAAAATGAAGATGG - Intergenic
1009458993 6:63889934-63889956 AAGCAGATGAAAAAAAAAGCAGG + Intronic
1009979293 6:70708110-70708132 AAGGAGAGGAAACAGGAAGAGGG - Intronic
1010286153 6:74080475-74080497 ATGGAGAGGAAAAATCAATATGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010496713 6:76541690-76541712 ACAAAGATGAAAAAAGAAGATGG + Intergenic
1010916869 6:81630845-81630867 CACAAGATGAAAAATAAAGAAGG - Intronic
1011293943 6:85807273-85807295 AAGAAGAAGAAAAAAGAAAAAGG - Intergenic
1011451024 6:87492345-87492367 AATGACATGAAAAAAAAAGATGG - Intronic
1011455173 6:87540868-87540890 AAGGAGGTGAAAGATGTAAATGG + Intronic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1012182527 6:96172374-96172396 AATGATATGAAAAATGTATATGG - Intronic
1012232523 6:96777209-96777231 AAGGAGAAGAAAGAGGGAGAGGG - Intergenic
1012323285 6:97879317-97879339 GGGGATATGAAAAATGAAGTTGG - Intergenic
1012333429 6:98023075-98023097 AAGGAGATGCAGAAGGAATATGG - Intergenic
1012489155 6:99761234-99761256 ACGGACTTGAAAAATGAAAATGG - Intergenic
1012604878 6:101145400-101145422 AAAGAGATAGAAAATGATGATGG + Intergenic
1012699690 6:102438840-102438862 AAAGAGAGGAAAAAAAAAGAGGG + Intergenic
1012714033 6:102646514-102646536 AAGCAGAGGAAAAATGAAAGGGG + Intergenic
1012736165 6:102947680-102947702 AAGGACGTGAAAAATGCAAAAGG + Intergenic
1012754314 6:103205657-103205679 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1012810730 6:103954147-103954169 AAGAAGAGGAAAAATTAAGTGGG + Intergenic
1012943486 6:105441770-105441792 AAGGAGATGGCAAATGGACATGG + Intergenic
1013176025 6:107677632-107677654 AAGGTCATGAAAAAGAAAGAAGG - Intergenic
1013302376 6:108816656-108816678 AACGAGATAGAAAATGAACAAGG - Intergenic
1013492578 6:110663337-110663359 AAGTATATGAAATATGAATATGG - Intronic
1013702615 6:112791810-112791832 AATGAGATGATAAATGAAAGAGG - Intergenic
1013731510 6:113173577-113173599 AAGGAGAGTAGACATGAAGAGGG + Intergenic
1013819870 6:114141975-114141997 AATGAGATGGAACATGAAGCAGG - Intronic
1014032157 6:116718183-116718205 AAACAGAGTAAAAATGAAGAAGG - Intronic
1014178145 6:118352317-118352339 AAGCAGCTTAAAAATGAAAAAGG + Intergenic
1014323799 6:119966371-119966393 AAGGAGATGGAATAGGAAGGTGG - Intergenic
1014341753 6:120217293-120217315 AAGGAGATCAAAAATGAAGTGGG + Intergenic
1014398152 6:120952791-120952813 AACAAGATAAAAAATGAACAAGG + Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014611424 6:123552465-123552487 CAGGATATGAAAAATAAAGAAGG - Intronic
1014687157 6:124515688-124515710 AAAGCGAAGAAAAATGAAGTAGG - Intronic
1014790489 6:125666633-125666655 AGGGAGATGGAAGATAAAGAAGG - Intergenic
1014856071 6:126402329-126402351 CAGGAGAAGAAAGATGGAGAGGG - Intergenic
1014926462 6:127276818-127276840 AAGGAACTGAAAATTGAGGATGG + Intronic
1015169220 6:130232415-130232437 AAGGAGCAGAAAAATGAAACAGG - Intronic
1015190977 6:130471881-130471903 AAGGAGAGAAAAAAGGAAGTTGG - Intergenic
1015442316 6:133263383-133263405 AAGAGGAGCAAAAATGAAGATGG - Intronic
1015468429 6:133574895-133574917 AAGAAGAGGAAAGAAGAAGAAGG + Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016217716 6:141623231-141623253 AATGAGATGAATCATGAAAAAGG + Intergenic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1016689651 6:146922294-146922316 AATGAGATGAGAGATGAGGAGGG + Intergenic
1016793736 6:148095197-148095219 AAAGAGATGAAAATGGGAGATGG + Intergenic
1017081746 6:150676095-150676117 AAGGAGGAGAAAATTGAAAAGGG + Intronic
1017171360 6:151458482-151458504 AAAGTGATGGAAAATCAAGATGG + Exonic
1017641641 6:156500184-156500206 AAGGAGATGCTAAAGGAATAGGG - Intergenic
1018256673 6:161926923-161926945 AAGGAGAAGCAAAATTTAGAGGG - Intronic
1018302993 6:162423417-162423439 AAGGAAATAAAAAATGAAAGAGG - Intronic
1018520092 6:164639523-164639545 AAGTTGATTAAAAATAAAGATGG + Intergenic
1018537557 6:164837669-164837691 AAGGAAATTAAAAATGCATATGG - Intergenic
1019221675 6:170478321-170478343 CAGGAGATGAAGCCTGAAGAGGG - Intergenic
1019474897 7:1239676-1239698 TTGGAGATGAGAAATGGAGATGG - Intergenic
1019764219 7:2837780-2837802 AAGGAAATGACAACAGAAGAAGG + Intronic
1019793152 7:3030424-3030446 AAGTAGATGAAAAATGGTGCTGG - Intronic
1020029949 7:4925644-4925666 GGGGAGATGAAAAAGGGAGAAGG - Intronic
1020062679 7:5164342-5164364 AAAAAAATAAAAAATGAAGAAGG + Intergenic
1020535427 7:9390059-9390081 AAGTTGATTAAAAATGTAGATGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020611629 7:10404478-10404500 AAGGAAAAGAAAAAGAAAGAAGG + Intergenic
1020734436 7:11929525-11929547 AAAGATAAGCAAAATGAAGAAGG + Intergenic
1020737348 7:11967745-11967767 AGGGCAATGAAAAATTAAGAAGG + Intergenic
1020805221 7:12781650-12781672 AAGAAGATTAAAAATAAATAAGG + Intergenic
1021132588 7:16928973-16928995 AAGGGGAAAAAAAATAAAGATGG - Intergenic
1021151439 7:17155954-17155976 AAGGAGAAGAAAAATAAACTGGG + Intergenic
1021163537 7:17305367-17305389 AAGGAAATGAAGAATGAATGGGG + Intronic
1021337273 7:19419347-19419369 GAGGAGATGAGAAATGTTGATGG + Intergenic
1021463962 7:20920870-20920892 AAGAACGTGAAACATGAAGAAGG + Intergenic
1021749091 7:23777375-23777397 AATGAGATGGAAAATTAACAAGG - Intronic
1021795716 7:24251923-24251945 AAGGAGAAGAAAGAGGAAAAGGG + Intergenic
1021834900 7:24660410-24660432 AAGGAGGTGAAAGGTGAAAAAGG - Intronic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1021956751 7:25832962-25832984 AAAGAGAAGAGAAATTAAGAAGG - Intergenic
1022317695 7:29260844-29260866 AATGAGATGAAACGTGATGAGGG - Intronic
1022633843 7:32112267-32112289 AAGAAGATGAAAAAAGATGAAGG - Intronic
1023295882 7:38714766-38714788 AAGGATATTAAAAAAGAAGGAGG - Intergenic
1023538941 7:41244291-41244313 AAGGAGATGGAAATGGAAAATGG - Intergenic
1023688678 7:42763689-42763711 AAGGAGAAAAAAAAAAAAGAAGG - Intergenic
1023694494 7:42830653-42830675 AAGGAGGTGAACATAGAAGATGG + Intergenic
1023883995 7:44338498-44338520 AAGGGCATGAAGAAGGAAGAGGG + Intergenic
1024195447 7:47054009-47054031 CAGGAGGTGAAAGATGCAGATGG - Intergenic
1024217506 7:47259799-47259821 AAAGAAAAGAAAAAGGAAGAAGG - Intergenic
1024234672 7:47388887-47388909 AAGAAGAAGAAAGAAGAAGAAGG + Intronic
1024472623 7:49778823-49778845 AAGTACATGGAAAATGAAAAAGG + Intronic
1024493845 7:50019375-50019397 AAGGAGATGAACACTTAAGGAGG - Intronic
1024556830 7:50610972-50610994 AAGGAAATGAAAAAGGAAAGTGG - Intronic
1024793270 7:52991734-52991756 AACCAGCAGAAAAATGAAGATGG + Intergenic
1024951687 7:54867457-54867479 AAGTAGATAGAAAATGAATAAGG - Intergenic
1025057917 7:55779961-55779983 AAGAAGATGAAAAATGAGGCTGG - Intergenic
1025184580 7:56847575-56847597 AACGACCTGAACAATGAAGATGG - Intergenic
1025270444 7:57507773-57507795 ATGAAGGTGAACAATGAAGAAGG + Intergenic
1025687349 7:63729393-63729415 AATGACCTGAACAATGAAGATGG + Intergenic
1025800275 7:64780295-64780317 AAGAGAATGAAAAATGTAGAGGG - Intergenic
1025821838 7:64969461-64969483 AACAAGATGAAAAAAGAAAAAGG - Intergenic
1025837328 7:65106472-65106494 AAGGAAAAGAAAAAGGAAAAAGG - Intergenic
1026095362 7:67342262-67342284 AAGGAGATAAATGCTGAAGAAGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026290943 7:69005508-69005530 AAAGAGATTAAACCTGAAGAGGG - Intergenic
1026373050 7:69721088-69721110 AAGGAGATGAAGAATGACCAGGG + Intronic
1026542815 7:71295551-71295573 AAGGAAAGGAAAAAGGAAGGAGG - Intronic
1026671913 7:72398108-72398130 AAGAAGAGGAGAAATAAAGATGG + Intronic
1026905084 7:74058207-74058229 AAGAAGAAGAAAGAAGAAGAAGG - Intronic
1026905094 7:74058337-74058359 AAGGAGAAGAAAGAAGAAGGAGG - Intronic
1027367396 7:77472743-77472765 AAGGAGAGGAAGGATTAAGAGGG + Intergenic
1027796703 7:82703522-82703544 AAGGAGCTGAAAAATGTACAAGG + Intergenic
1027953649 7:84852326-84852348 AAGGAAATAAAAAAGAAAGACGG + Intergenic
1028179805 7:87705915-87705937 AAGAAAATGAAAAAGCAAGAAGG - Intronic
1028467786 7:91172412-91172434 AAGCAGATGAAGGATAAAGAGGG - Intronic
1029094882 7:98077226-98077248 AAGAAGAAGAAACAGGAAGAAGG + Intergenic
1029202644 7:98849310-98849332 AAGGAGATGCAACAAGAAGAGGG + Intronic
1029322527 7:99777250-99777272 AAGGAAAAAAAAAAAGAAGAGGG + Intronic
1029872081 7:103705016-103705038 AAGCAGGAGAAAAATCAAGAGGG - Intronic
1029959186 7:104671307-104671329 AAGGAGAGTAGACATGAAGAGGG - Intronic
1030462405 7:109855904-109855926 AAGAAGAGGAAGAAGGAAGAAGG + Intergenic
1030555050 7:111013483-111013505 AGGGAGATGAAAACGGAAGGAGG + Intronic
1030807544 7:113936387-113936409 AAGGAGATGGAGAAGGAAGTTGG - Intronic
1030893841 7:115031888-115031910 GAGGAGATGAAGAATGAACTTGG + Intergenic
1030983601 7:116214070-116214092 GAGGAGAGAAAAAATGAACACGG - Intronic
1031149128 7:118032471-118032493 AAAGAGAGAAAAAAAGAAGAAGG - Intergenic
1031177768 7:118374421-118374443 AAGAAGATGAAAGAGGGAGATGG + Intergenic
1031209041 7:118798565-118798587 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
1031250388 7:119372840-119372862 AACGTGATCAAAAATGAAAAGGG + Intergenic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031446342 7:121859567-121859589 AAGGAGAGGAGAAATAAATATGG - Intergenic
1031515709 7:122695849-122695871 AAGAAAAGGAAAAATGAACAAGG + Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031871813 7:127095961-127095983 AAGAAGATTCAAAATGAAAAAGG + Intronic
1032378839 7:131454222-131454244 AAGGAGAAAAAATCTGAAGACGG + Intronic
1032817993 7:135496705-135496727 TAGGAGAGGTAAAAGGAAGATGG - Intronic
1032901387 7:136313080-136313102 CAGGAAATGAAAAATCAATAAGG - Intergenic
1033192800 7:139297419-139297441 AAGGAGTTGAAAGATGTAGTGGG + Intronic
1033252311 7:139771434-139771456 AAGTACAAGAAAAATAAAGACGG + Intronic
1033522514 7:142175518-142175540 AATGAGATGAGGAATGAAGAGGG + Intronic
1034271145 7:149803916-149803938 CAGGGGATGAAGGATGAAGAAGG + Intergenic
1034310251 7:150081320-150081342 AAAGAAAAGAAAAAGGAAGAAGG + Intergenic
1034634898 7:152559487-152559509 AAGGGAATAAAAAAGGAAGAGGG - Intergenic
1034714246 7:153225058-153225080 AAAAAGATGAAAAACTAAGAGGG + Intergenic
1034796592 7:154019333-154019355 AAAGAAAAGAAAAAGGAAGAAGG - Intronic
1035936926 8:3851738-3851760 AAGAAGGTGAGGAATGAAGAGGG + Intronic
1036094835 8:5712137-5712159 AAGGAGATGAGACAGGTAGATGG + Intergenic
1036717081 8:11135718-11135740 AAGGAGAAAAAAATTAAAGAAGG + Intronic
1037099761 8:15030798-15030820 AAAGAAATGAAAAGTGAAGCAGG + Intronic
1037205680 8:16316924-16316946 AAGGATTTTAAAAATGAAGTTGG + Intronic
1037222426 8:16540528-16540550 AAGGAGATAAAAAATGTAGAAGG + Intronic
1037303461 8:17479328-17479350 AAGGAGCTGAAAAGTAAAGTAGG - Intergenic
1037615781 8:20517852-20517874 AGGGAGATGAAACATGCAGAAGG + Intergenic
1037635755 8:20700122-20700144 AAGGAGGTGAAAGGGGAAGATGG + Intergenic
1037698754 8:21252479-21252501 AAAAAGAAGAAAAAAGAAGAAGG + Intergenic
1037765112 8:21767974-21767996 GAGCAGATGAAAACAGAAGAGGG + Intronic
1038064534 8:23949980-23950002 AAGGAGATGGAAAGGGGAGATGG + Intergenic
1038087008 8:24209464-24209486 AAGAAAATGACAAAGGAAGAAGG + Intergenic
1038495895 8:28002274-28002296 AAGGTGAAGAAAAATTGAGAAGG + Intergenic
1038898298 8:31812587-31812609 GAGGAGATAAAAAAGGAAGGAGG - Intronic
1039157718 8:34580411-34580433 AAGGAGAACAAAAATAATGATGG - Intergenic
1039471919 8:37818801-37818823 AAGGAGGTGAGAAAGCAAGAGGG + Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040365731 8:46713126-46713148 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1040429510 8:47325152-47325174 GAGAAGTTCAAAAATGAAGATGG + Intronic
1040592885 8:48811418-48811440 AAAGAGAAGAGAAAAGAAGAAGG + Intergenic
1041401400 8:57448890-57448912 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1041585832 8:59517820-59517842 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042311056 8:67379812-67379834 AAGGAGAAGAAAGAGAAAGAGGG - Intergenic
1042369962 8:67980433-67980455 AAGGATATGCAAAATGGAGGGGG + Intronic
1042458026 8:69028487-69028509 AAAAAGAAAAAAAATGAAGAAGG + Intergenic
1042553478 8:70014780-70014802 AAGGAGAAGAAAGAAGAAGAAGG - Intergenic
1042712241 8:71731080-71731102 AAGGCTAGGAAAAATGAGGAAGG - Intergenic
1042748301 8:72131537-72131559 AAGGAGAAGAAAAAGGAAGGAGG - Intergenic
1042786530 8:72552891-72552913 AAGGAGAGAAACAAAGAAGAGGG - Intronic
1042787456 8:72565245-72565267 AAGGTAATGAAAAATGTAGATGG - Intronic
1042975212 8:74461115-74461137 TAAGAGCAGAAAAATGAAGAGGG - Intronic
1043041343 8:75265760-75265782 AGAGAGATAAGAAATGAAGATGG - Intergenic
1043118116 8:76286131-76286153 AATGAGATGGAAAATTAACAAGG - Intergenic
1043403801 8:79910477-79910499 AAGGGGATGAAAAATTGGGATGG + Intergenic
1043463487 8:80483875-80483897 AAGGTGATGGGAAATGAAAATGG - Intergenic
1043538131 8:81228530-81228552 AAGGAGAGCAAAAGTGGAGAAGG + Intergenic
1043632583 8:82354857-82354879 AAGGAGATGAATACTGAAGAAGG + Intergenic
1043778143 8:84296461-84296483 AAGGAAAGGAAAGATGAACATGG - Intronic
1043991538 8:86761557-86761579 AACAAAATGAAAAATAAAGAAGG - Intergenic
1044528145 8:93275635-93275657 AAGGAAAAGAAAAAACAAGATGG + Intergenic
1045092500 8:98760785-98760807 AGGGAGCTGTAAAGTGAAGATGG - Intronic
1045229353 8:100287103-100287125 AAAGAGAAAAAAAATAAAGAAGG + Intronic
1045370147 8:101514913-101514935 AAGGAGAAGAAGAAAGAACAAGG - Intronic
1045605028 8:103763436-103763458 AAGGAAAAAAAAAAAGAAGAAGG + Intronic
1045758807 8:105578237-105578259 AAGAAGATGCAAAATGAAAATGG - Intronic
1045773227 8:105770011-105770033 AAGGAAACAAAAAATGAAGGTGG - Intronic
1045994862 8:108351327-108351349 GAGGAGAGCAAAAATAAAGAGGG + Intronic
1046064403 8:109179587-109179609 AGAGAGGAGAAAAATGAAGATGG - Intergenic
1046120558 8:109841171-109841193 AAGGAGAGGAGATTTGAAGAGGG - Intergenic
1046181779 8:110658667-110658689 AAGCAGATCAAAAATGACAAAGG + Intergenic
1046551861 8:115728261-115728283 AAGGAAATGAAAAATCTATAAGG - Intronic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1047080674 8:121456354-121456376 AAGGAAATGTGATATGAAGAGGG - Intergenic
1047116478 8:121847309-121847331 AAGAAAATGATAACTGAAGAAGG + Intergenic
1047281043 8:123445974-123445996 AAGGAAAGGAAAAAGGAAAAAGG - Intronic
1047398072 8:124521166-124521188 AAAGCTATGAAAAATGAAGTAGG + Intronic
1047570218 8:126089658-126089680 AAGGATAAGAAAAATCAAGGTGG - Intergenic
1047887550 8:129268565-129268587 GAGGAAATGAAGAATGAAAAAGG - Intergenic
1048161871 8:132028777-132028799 AAAGAGAGGAAGAAAGAAGAAGG + Intronic
1048423263 8:134297944-134297966 AAGGAGATGAAAAAGAATGGAGG + Intergenic
1048467309 8:134676535-134676557 AATGAGATGGAAAATTAACAAGG + Intronic
1048476755 8:134749966-134749988 AAGAAAAAGAAAAATGTAGAAGG - Intergenic
1048599648 8:135906230-135906252 CAGGCGAGGAAAAAGGAAGAAGG - Intergenic
1048664343 8:136644022-136644044 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1048802651 8:138208047-138208069 AAGGAGATGGAATCTGAAGTTGG - Intronic
1049004570 8:139846516-139846538 AATAAGAAGAAAAATGAAGATGG + Intronic
1049311825 8:141937520-141937542 AAGGAGAGAGAAAAGGAAGAAGG - Intergenic
1049479548 8:142815062-142815084 AAAGAGATCAACAGTGAAGAGGG - Intergenic
1049514850 8:143048816-143048838 AAGGAGGTGGAAAATGCATAAGG - Intronic
1049899828 9:148799-148821 CAGGAGAGTGAAAATGAAGAGGG + Intronic
1049954797 9:682646-682668 AAGGAGGAGAAAAATGACCAGGG - Intronic
1050159651 9:2704260-2704282 ATGGAGAAGAAAAATAAATAAGG + Intergenic
1050412974 9:5385541-5385563 AAGGAAATGAAAAATGGTCAGGG - Intronic
1050536235 9:6633273-6633295 AAGGAAATAAAACATGCAGAAGG - Intronic
1050606154 9:7303525-7303547 AAGGAGAGGAAGAAGGGAGAGGG + Intergenic
1050672570 9:8014377-8014399 AAGGGGATGAAAGATGGAGATGG + Intergenic
1050677621 9:8073734-8073756 AAAGAGAAAAAAAATGAAAACGG + Intergenic
1050767815 9:9157584-9157606 AAAGAGACCAAAAATGAGGAAGG + Intronic
1051178050 9:14380967-14380989 AATCAGATGAACAATGAAGGAGG - Intronic
1051219338 9:14831943-14831965 ATGGAGATGAAAACAGTAGAGGG - Intronic
1051382522 9:16472649-16472671 TAAGAGATGTAAAAAGAAGAAGG - Intronic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1051661129 9:19427974-19427996 AAGGAAAGGAAAAAGGAAAAAGG - Intronic
1051661133 9:19427998-19428020 AAGGAAAGGAAAAAGGAAAAAGG - Intronic
1052065945 9:24020315-24020337 AAGGAGATCAAAAATTTTGAAGG - Intergenic
1052200791 9:25777119-25777141 AATGAGAAGAAAAATGAAAGTGG + Intergenic
1052619379 9:30886028-30886050 GAGGAGATGGAAAAAGAAAAGGG + Intergenic
1053138708 9:35668376-35668398 ATGTAGATGAAAAATTTAGAAGG + Intronic
1053244053 9:36519944-36519966 AAGAAGAAGAAAGAAGAAGAGGG - Intergenic
1053637273 9:40023741-40023763 AAGGAAATGACAAATGTACAAGG - Intergenic
1053722889 9:40965714-40965736 AAGGAGTTCAAAAAGTAAGAAGG - Intergenic
1053768754 9:41441177-41441199 AAGGAAATGACAAATGTACAAGG + Intergenic
1054318108 9:63620632-63620654 AAGGAAATGACAAATGTACAAGG - Intergenic
1054343080 9:63886285-63886307 AAGGAGTTCAAAAAATAAGAAGG + Intergenic
1054547421 9:66352656-66352678 AAGGAAATGACAAATGTACAAGG + Intergenic
1054963651 9:70997569-70997591 AATGAAAACAAAAATGAAGATGG - Intronic
1055023989 9:71699756-71699778 GAGGAGATGGAAAAAGAAGTGGG - Intronic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055604666 9:77956399-77956421 AAGGACATGAAAAAGGAAGCTGG - Intronic
1055650635 9:78403603-78403625 AGGCAGATGAAAAAGGAAAAAGG - Intergenic
1055664890 9:78543497-78543519 AGGGAGAAGAGAAATGAAGCGGG - Intergenic
1056271945 9:84955254-84955276 AAGGACATGGAGAATGAAGCTGG - Intronic
1056527647 9:87458083-87458105 ATGGAGATGAGAAGTAAAGAAGG + Intergenic
1056783232 9:89567573-89567595 AAGGAATTGAAACATGAAAAAGG - Intergenic
1056806583 9:89733499-89733521 AAGGAAATGAAGAGGGAAGAAGG - Intergenic
1057334586 9:94145969-94145991 AAGGAGATGACAGATACAGAAGG - Intergenic
1057875973 9:98754803-98754825 ATTGGGATGAAAAAAGAAGAGGG - Intronic
1058170436 9:101674123-101674145 TAAGAGATGAAAAATAAGGAGGG + Intronic
1058250737 9:102692589-102692611 CAGAAGATGAAAAATGATGAAGG + Intergenic
1058271609 9:102979258-102979280 CATGAGATGAAAAATGAAAAGGG + Intergenic
1058300433 9:103364844-103364866 AAGGAAATGAAAGATGGTGAGGG - Intergenic
1058387524 9:104455898-104455920 AAAGAGAAGAAAAATTAAAATGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059170529 9:112120374-112120396 AGGGAAAAGAAAAAAGAAGAGGG + Intronic
1059352634 9:113676562-113676584 AAGGGGATCAGAAATGAAGCTGG + Intergenic
1059443903 9:114326325-114326347 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059445110 9:114333102-114333124 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059532204 9:115045700-115045722 AAGGAGAAAAAAAAAAAAGATGG - Intronic
1059549384 9:115213570-115213592 TAGGAGATGAACAATTAATAAGG - Intronic
1059579533 9:115529288-115529310 AAGGTGATGCAACAGGAAGATGG - Intergenic
1059708334 9:116844265-116844287 TAGGAGAAGAATAATGAACATGG - Intronic
1059868265 9:118541689-118541711 AAAGAAAAGAAAAATGAAGGAGG - Intergenic
1059906526 9:118992521-118992543 AAGGACAGGAAAAATGAAGCAGG + Intergenic
1060135690 9:121151367-121151389 AAGAAGAAGAAAAAAGAAAAAGG - Intronic
1060136558 9:121161077-121161099 AAGTAGGTAAAAAATGAATATGG + Intronic
1060268021 9:122123425-122123447 ACGGAGATGAGGACTGAAGAGGG - Intergenic
1060747517 9:126147287-126147309 AAGGAGAAGAAAATGGGAGAGGG + Intergenic
1061440911 9:130602815-130602837 AAGGAGCTGAAAAAGGAACCTGG - Intronic
1061751425 9:132780173-132780195 AATGAACTGAAAGATGAAGAAGG + Intronic
1202785142 9_KI270719v1_random:7325-7347 AAGGAAATGACAAATGTACAAGG - Intergenic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185479215 X:433677-433699 AAGGCAATGAAGAAGGAAGAAGG + Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185999255 X:4989537-4989559 AGGGAGAAGAAAAAAGAAGTAGG - Intergenic
1186113374 X:6278825-6278847 AAGGAGATGAAAAATTCCAAAGG + Intergenic
1186137948 X:6539356-6539378 GAAGAGATGTGAAATGAAGATGG + Intergenic
1186361441 X:8846105-8846127 AAGGAGAAGGAAGAGGAAGAAGG - Intergenic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1186672733 X:11783231-11783253 AAGGAAAAGAAAAGTAAAGAAGG + Intergenic
1187134722 X:16536106-16536128 AAAGAGATGAAAAATATAAAAGG - Intergenic
1187167543 X:16818537-16818559 AAGGAGAAAAAAGATGGAGAAGG - Intronic
1187264480 X:17718675-17718697 AAGGAAAGCAAAAAGGAAGAAGG + Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187549050 X:20282970-20282992 AAGGAGTTGCAAATTCAAGATGG - Intergenic
1187551427 X:20309785-20309807 AAGGCGATCAAAGATGGAGAAGG + Intergenic
1187781510 X:22831827-22831849 AGGGGGAAGAAAAAGGAAGATGG - Intergenic
1188061798 X:25610485-25610507 AGGAAGATGAAAAAGTAAGAGGG - Intergenic
1188061979 X:25612030-25612052 AGGAAGATGAAAAAGTAAGAAGG + Intergenic
1188361468 X:29260099-29260121 AAAGAGGTGAAAAATAAGGAAGG - Intronic
1188448156 X:30279051-30279073 AAGGAGAAAAAAATGGAAGATGG + Intergenic
1188518231 X:31010458-31010480 AAGGAGAAGAAAAAGTGAGATGG - Intergenic
1188521840 X:31046710-31046732 AAGGATCTGAGAAATGAAGAGGG - Intergenic
1188741190 X:33784667-33784689 AAGGAAAAGAAAAAGAAAGAAGG - Intergenic
1189307440 X:39997495-39997517 AAGGAATTGCAAAAGGAAGAGGG - Intergenic
1189550590 X:42088479-42088501 AAGAAGATAAAAAATTAAAATGG - Intergenic
1189663624 X:43329601-43329623 TAGGAGATAAAAACTGAATATGG - Intergenic
1190568428 X:51755625-51755647 AAAGAGAAGAAAAAGGAACAAGG - Intergenic
1190751564 X:53366478-53366500 ATGGAGCTGAAAAATGGAGGAGG - Intergenic
1190804021 X:53818157-53818179 ATGGAGCTGAAAAATGGAGGAGG - Intergenic
1191109872 X:56796089-56796111 AGGGACAAGAAAGATGAAGAGGG - Intergenic
1191110039 X:56797109-56797131 AAGAAGAAGAAAGAAGAAGAGGG - Intergenic
1191590883 X:62883332-62883354 GAGGAGGTTTAAAATGAAGAAGG - Intergenic
1191904309 X:66072766-66072788 AAGGAGAGTAGACATGAAGATGG + Intergenic
1191926097 X:66311781-66311803 AAGGAAGTCAGAAATGAAGAAGG + Intergenic
1192130374 X:68544028-68544050 AAGGAAACTAATAATGAAGATGG - Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1192397788 X:70800667-70800689 AAGCACATGAAATAGGAAGAAGG - Intronic
1192772678 X:74208737-74208759 AAGGAAAGGAAAAAGGAAAAAGG + Intergenic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193334901 X:80276333-80276355 AATGAGATGGAAAATTAAAAAGG + Intergenic
1193738801 X:85193228-85193250 ATGGGGAGGAAAAATGATGATGG + Intergenic
1194329266 X:92560707-92560729 AAGGGGATGGAAGATGTAGAAGG + Intronic
1194591569 X:95805790-95805812 AAGGAGAGGGAAAAGTAAGAAGG + Intergenic
1194649100 X:96493944-96493966 GGGCAGATGAACAATGAAGAAGG + Intergenic
1194700903 X:97112427-97112449 AAGGAAAGGAAAAATAAAGTGGG + Intronic
1194865038 X:99054785-99054807 AAGGTGATGGAATTTGAAGATGG - Intergenic
1194964271 X:100269399-100269421 AACGAGATGGAAAATTAACAAGG + Intergenic
1195510419 X:105709777-105709799 AAGGAAATGAAAAAGGAAAAAGG + Intronic
1195521970 X:105841400-105841422 AAAGAGAGGGAAAATGAAGTGGG + Intronic
1195593601 X:106661544-106661566 AAGGAGAGAAGTAATGAAGAAGG + Intronic
1195620389 X:106948067-106948089 AAAAAGAGGAAAAATAAAGATGG - Intronic
1195704246 X:107727205-107727227 AATGATATGAAAAATTGAGAGGG + Intronic
1195710069 X:107766508-107766530 AAGCAGATACAAAAGGAAGAGGG + Intronic
1195733423 X:107988933-107988955 AAGGAAATAAAAAATGATAAAGG - Intergenic
1195946779 X:110222684-110222706 AAGAAGCTGAAAAAAGAAGTAGG + Intronic
1195979097 X:110558978-110559000 AATGAGATGGAAAATTAACAAGG - Intergenic
1196079650 X:111617891-111617913 AAGGAGAGTAGACATGAAGAGGG + Intergenic
1196153624 X:112403198-112403220 AAGTAAATGAAAAAGAAAGAAGG - Intergenic
1196425174 X:115562003-115562025 AAGGAGCTGAAAAAAGGACAGGG - Intronic
1196518152 X:116639198-116639220 AAGGAAATGAAAAGTGTAAATGG - Intergenic
1196527329 X:116741408-116741430 AAGGAGATTAAAAAAAAAAAAGG - Intergenic
1196731106 X:118942317-118942339 AAGGAGAAGAAAGAAGGAGAAGG + Intergenic
1196942489 X:120791089-120791111 AAGAAGAAGAAAAAGAAAGAAGG - Intergenic
1196975919 X:121157503-121157525 AAGAAGATAGAAAAAGAAGAAGG + Intergenic
1197389730 X:125845654-125845676 ATGGAGATCAAAAATGAATAAGG - Intergenic
1197459465 X:126722754-126722776 AATGAGATGAAAAATGACTGGGG - Intergenic
1197698792 X:129580604-129580626 ACGGAGATGAAAAAAGTTGAGGG + Intronic
1197816488 X:130504095-130504117 AAGGAAATAAGAAATAAAGAAGG - Intergenic
1198139848 X:133791781-133791803 AAGGAAAAGAAAAAGGAAAAAGG - Intronic
1198179722 X:134194566-134194588 AAGGAGAAAGAAAAAGAAGAAGG - Intergenic
1198227670 X:134660622-134660644 AAAGAGATGAAAAATAAGAAAGG + Intronic
1198317633 X:135485148-135485170 CAAGAGATAAAAAATGACGATGG - Intergenic
1198447411 X:136731159-136731181 GAGAATATGAAAAATCAAGAAGG - Intronic
1198449680 X:136754613-136754635 AAGAAAAAGAAAAAAGAAGAAGG + Intronic
1198511731 X:137358836-137358858 AGAGAGATGCAAAATGAAGATGG - Intergenic
1198856508 X:141022770-141022792 AAGGACATAAAGAAAGAAGAAGG + Intergenic
1198906184 X:141564597-141564619 AAGGACATAAAGAAAGAAGAAGG - Intergenic
1199090354 X:143684365-143684387 TAGGAGAGGGAAAAGGAAGAAGG + Intergenic
1199145711 X:144363715-144363737 CTGGAGATGAAAAATGCAGCAGG + Intergenic
1199295235 X:146149864-146149886 AAGGAGATGAGAAATGCAGAGGG - Intergenic
1199337248 X:146632713-146632735 AAGGAGAAAAGAAATAAAGATGG - Intergenic
1199573912 X:149294473-149294495 AATGAGTTGAAAAATGAAGGTGG + Intergenic
1199585167 X:149407086-149407108 AAGGAGATGCAAAAAGAAGAAGG + Intergenic
1199585384 X:149410771-149410793 AAGATGAAGAAAAATGAACAAGG - Intergenic
1199996669 X:153030481-153030503 GAGGAGTTGGAAAATGAGGATGG + Intergenic
1200269855 X:154672231-154672253 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1200637965 Y:5679896-5679918 AAGGGGATGGAAGATGTAGAAGG + Intronic
1200894844 Y:8364288-8364310 AAGCAGATGAAAAATATTGAAGG - Intergenic
1200984165 Y:9288544-9288566 AAGGAACTGAAAAATGTAGCAGG + Intergenic
1201191268 Y:11443310-11443332 AAGGAGATGAAATGAGATGATGG + Intergenic
1201503095 Y:14667373-14667395 AAATAGATGAAAGATGAAGTTGG + Intronic
1201547048 Y:15177116-15177138 AAAGAAATGAAAAAAGAAAAAGG - Intergenic
1202126282 Y:21571698-21571720 AAGGAACTGAAAAATGTAGCAGG - Intergenic