ID: 1120816617

View in Genome Browser
Species Human (GRCh38)
Location 14:88866579-88866601
Sequence TAGTCAATGCAGCTGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120816617_1120816621 2 Left 1120816617 14:88866579-88866601 CCAAGTTCCAGCTGCATTGACTA 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1120816621 14:88866604-88866626 CCGCCCCCCTTTTGTACTTAGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1120816617_1120816628 21 Left 1120816617 14:88866579-88866601 CCAAGTTCCAGCTGCATTGACTA 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1120816628 14:88866623-88866645 AGGGCTTGGTGACACCTATTTGG 0: 1
1: 0
2: 0
3: 1
4: 92
1120816617_1120816625 7 Left 1120816617 14:88866579-88866601 CCAAGTTCCAGCTGCATTGACTA 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1120816625 14:88866609-88866631 CCCCTTTTGTACTTAGGGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 79
1120816617_1120816619 1 Left 1120816617 14:88866579-88866601 CCAAGTTCCAGCTGCATTGACTA 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1120816619 14:88866603-88866625 ACCGCCCCCCTTTTGTACTTAGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120816617 Original CRISPR TAGTCAATGCAGCTGGAACT TGG (reversed) Intronic
900859725 1:5219626-5219648 TGGTCAAACCAGCTGAAACTGGG + Intergenic
901516846 1:9753470-9753492 TAGTCACTGCTGGTGGAAGTAGG - Intronic
902113233 1:14100276-14100298 GAGTCAATGAATGTGGAACTGGG + Intergenic
903451710 1:23458019-23458041 TAGGAAAAGCACCTGGAACTTGG - Intronic
911165548 1:94721251-94721273 TAGAGAATGCAGCTGGGAGTCGG + Intergenic
911293444 1:96084707-96084729 GAGTCAGTGCAGCTGGACTTTGG - Intergenic
912430889 1:109627812-109627834 TAGCACATGCATCTGGAACTTGG - Exonic
916998468 1:170328225-170328247 TTATGAATGCAGCTGAAACTGGG - Intergenic
917550885 1:176027736-176027758 TAGTAAATGCTTCTGTAACTTGG + Intronic
920081761 1:203379891-203379913 TATTTATTTCAGCTGGAACTCGG + Intergenic
920101358 1:203518898-203518920 TAGTGCATGCAGATGGACCTGGG + Intergenic
920744903 1:208617215-208617237 TAGTCATTACAGCTGGGAATGGG - Intergenic
921055236 1:211538209-211538231 AAGTCACTGCAGGTGGAAGTAGG - Intergenic
923054908 1:230418776-230418798 GAGCCACTGCATCTGGAACTAGG + Intronic
923580028 1:235200788-235200810 TAGTCAATGCAGATAGAAAATGG + Intronic
923822757 1:237464179-237464201 TAGTCCATGAACCTGGAATTTGG - Intronic
1067131814 10:43572214-43572236 TATTCACTGCCGCTGCAACTGGG - Intronic
1067234615 10:44437243-44437265 CAGTCAGTGTAGCTGGAACAGGG - Intergenic
1067832261 10:49616972-49616994 TAGTGATAGCAGCTGGAGCTGGG - Intronic
1068794602 10:61064795-61064817 TAGTAAATGCAGTAGAAACTAGG - Intergenic
1071349678 10:84727598-84727620 TAGCCAAGGAAGCTGAAACTGGG + Intergenic
1072567868 10:96632805-96632827 TAGTCAATACAGCCAGAAGTGGG - Intronic
1073382190 10:103087253-103087275 TAGGCAGGGCAGCTGTAACTGGG - Exonic
1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG + Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1080968857 11:37246225-37246247 TAGACAAAGCAGCTCCAACTGGG - Intergenic
1083300355 11:61736880-61736902 TAGTCATTGCATCTGTACCTGGG - Intronic
1084207490 11:67604464-67604486 AAGCCAAAGGAGCTGGAACTGGG + Exonic
1084773025 11:71356711-71356733 GAGGCCAGGCAGCTGGAACTGGG + Intergenic
1085560945 11:77473126-77473148 TATTCCATGCAGAAGGAACTGGG + Intronic
1086998264 11:93384540-93384562 TAATAAAAGAAGCTGGAACTAGG - Intronic
1087230119 11:95651832-95651854 AAGTCACTGAAGCTGGAAGTTGG + Intergenic
1089510655 11:118994885-118994907 AAGACAACGCACCTGGAACTTGG - Intergenic
1091643508 12:2255396-2255418 TAGTAAATGGACCTGGATCTAGG - Intronic
1092253302 12:6913369-6913391 TGGTGTATGCAGCTGGACCTAGG + Intronic
1096011757 12:48223050-48223072 TAGTGAATGCTCCTGGATCTTGG + Intergenic
1097069434 12:56344061-56344083 GAGTCATTAGAGCTGGAACTAGG - Exonic
1098222346 12:68283396-68283418 TAGTTAATGCAGCTGTATTTTGG - Intronic
1103500286 12:121396491-121396513 GAGTTAATGCAGCTGGAAAGTGG - Intronic
1105353832 13:19639757-19639779 TTGGCAATGCATCTGTAACTGGG - Intronic
1106373656 13:29162417-29162439 TAGACAAAGCATCAGGAACTTGG - Intronic
1113761164 13:112847630-112847652 TAATCAAAACAGCGGGAACTGGG - Intronic
1115318346 14:32050528-32050550 TATTCACTGCATTTGGAACTGGG + Intergenic
1116864166 14:50017913-50017935 TAGCTCATGTAGCTGGAACTTGG - Intergenic
1118084440 14:62398896-62398918 TACTGAATCCTGCTGGAACTGGG + Intergenic
1119939723 14:78627497-78627519 GAGTCACTGGAGCTGGCACTGGG - Intronic
1119951815 14:78752930-78752952 GAGTCAATGCAGCTGGCACCTGG - Intronic
1120816617 14:88866579-88866601 TAGTCAATGCAGCTGGAACTTGG - Intronic
1120825369 14:88950189-88950211 TAGTCAAAGCAGCTGGAATGAGG - Intergenic
1122533433 14:102445267-102445289 TATTCTGTGCAGCTGGACCTAGG - Intronic
1124624229 15:31299024-31299046 TAGACCATGCAGCTGGCCCTGGG - Intergenic
1128191032 15:65697427-65697449 TAGTGAGTGCAACTGGAATTAGG + Intronic
1131538494 15:93256625-93256647 TGGTCAGTGCAGGTGGAACTTGG + Intergenic
1133048567 16:3103221-3103243 CAGTCTTTGCAGCTGGAACATGG - Intergenic
1133879335 16:9765765-9765787 TATTCAATGTAGTTAGAACTGGG + Intronic
1135117903 16:19739133-19739155 TAGCCCTTGCAGGTGGAACTGGG + Intronic
1141827097 16:86488226-86488248 TATTCATGGCAGCTGGTACTCGG + Intergenic
1146517958 17:33503984-33504006 GAGGAAATGCAGCTGGAGCTGGG + Intronic
1148345577 17:46901485-46901507 GAGCCAATGCAGCTGGAGCTGGG + Intergenic
1151003463 17:70405403-70405425 TATTAAATGCAACTGGAACCAGG - Intergenic
1151920773 17:77153631-77153653 TAGTGCATGCAGCAGGCACTTGG + Intronic
1157704989 18:49798684-49798706 TTTTGAATGCAGATGGAACTGGG + Intronic
1158184062 18:54751322-54751344 TAGTCAACCAAGCTAGAACTTGG - Intronic
1165257997 19:34591653-34591675 TGGCCAGTGCAGCTGGAACAAGG - Intergenic
1165775375 19:38401281-38401303 TAGACAATTCTGCTGGAAGTTGG - Intergenic
925484750 2:4315971-4315993 TAGTAAATGCTGCCAGAACTGGG + Intergenic
926143375 2:10381998-10382020 TATTCATAACAGCTGGAACTTGG + Intronic
926277980 2:11419875-11419897 TAGTTTATGAAGCTGCAACTTGG - Intergenic
926583903 2:14663961-14663983 TGGTCTTTGAAGCTGGAACTGGG + Intergenic
927271656 2:21216668-21216690 TAGTCAATGTAGCTAAAACATGG + Intergenic
929092501 2:38233437-38233459 TACTAGATGCAGCTGCAACTAGG + Intergenic
934806427 2:97231294-97231316 TAAACAAAGCAGCTTGAACTGGG - Intronic
936629380 2:114185016-114185038 TAGGAAATGGATCTGGAACTAGG + Intergenic
942302000 2:174571816-174571838 TCGTCATTGCCGCTGGAACTTGG + Exonic
946777456 2:223158313-223158335 TGGTAAAGGCAGCTGGAAGTGGG + Intronic
946817950 2:223598311-223598333 TAGTAAATGCTGCAGGAAGTGGG - Exonic
1168853326 20:991223-991245 GAGTCAATGCACCTGGCTCTGGG + Intronic
1169559940 20:6788679-6788701 TATTAAATGCAGTTGTAACTGGG + Intergenic
1169791177 20:9412380-9412402 TAGGCAATACAGCAAGAACTAGG - Intronic
1170499081 20:16956166-16956188 TTCTCAATGCAGCTGGTAGTGGG + Intergenic
1171186617 20:23127851-23127873 TAGGCAAGGCAGCTTGACCTCGG + Intergenic
1172886515 20:38234774-38234796 TAATCAACTCAGCTGGCACTGGG - Intronic
1175085134 20:56451993-56452015 TAGAAAGTGGAGCTGGAACTGGG - Exonic
1179078991 21:38152582-38152604 TGGCCAGTGCAGCTGGAACAGGG + Intronic
1179087584 21:38232345-38232367 TAGTCAATCAAGCTGAAATTTGG + Intronic
1179261038 21:39758287-39758309 GAGTCAATGCAGGAGGAAATGGG - Intronic
1181039787 22:20186601-20186623 TAATCAATGCAGCTGATACTGGG - Intergenic
1182155080 22:28063922-28063944 TAGTCAATGAAGGTTTAACTGGG + Intronic
949977331 3:9473025-9473047 TATTTAAGGCAGCTGGAAATTGG - Intronic
951383774 3:22019756-22019778 TAATCTATGCTGCGGGAACTGGG + Intronic
953722554 3:45369035-45369057 TGATGAATGCTGCTGGAACTGGG - Intergenic
954453009 3:50581858-50581880 GAGTCCATGCAGCTGGGGCTGGG - Exonic
961176050 3:124835792-124835814 GAGTCAATTCTGCAGGAACTGGG + Intronic
961221872 3:125207496-125207518 TAGTATATCCAGCAGGAACTGGG + Intronic
964386646 3:156154767-156154789 TAGTCAGTGCTGCTGGGACTGGG + Intronic
971840115 4:31840351-31840373 TACACAGTGCGGCTGGAACTGGG - Intergenic
972588207 4:40458329-40458351 TAGTCATTTCAGTTGCAACTAGG + Intronic
975063623 4:70036602-70036624 TAGTCAGTGCTACTCGAACTGGG - Intergenic
976756276 4:88501336-88501358 TAGTGAATGCGGCAGGGACTTGG + Intronic
978596179 4:110379619-110379641 TAGGCAAAGCAGCTGAAACAGGG - Intronic
980770555 4:137366669-137366691 AAGTCAATGCAGTTGGTCCTTGG - Intergenic
982547967 4:156759329-156759351 TAGTCAATGCACCTGGAGACAGG + Intergenic
982547976 4:156759376-156759398 TAGTCAATGCACCTGGAGACAGG + Intergenic
982548004 4:156759517-156759539 TAGTCAATGCACCTGGAGACAGG + Intergenic
982548052 4:156759750-156759772 TAGTCAATGCACCTGGAGACAGG + Intergenic
982548080 4:156759889-156759911 TAGTCAATGCACCTGGAGACAGG + Intergenic
982548089 4:156759936-156759958 TAGTCAATGCACCTGGAGACAGG + Intergenic
982548117 4:156760077-156760099 TAGTCAATGCACCTGGAGACAGG + Intergenic
982788380 4:159561771-159561793 TTGTCCTTGCTGCTGGAACTGGG - Intergenic
989723170 5:44553734-44553756 TAATGAATGCTGCTGGGACTGGG + Intergenic
990708566 5:58557792-58557814 TAAACAAAGCAGCTCGAACTGGG - Intronic
993364624 5:87020363-87020385 CAGCCATTGCAGCTGGAACTGGG - Intergenic
993576519 5:89608586-89608608 TACTCAATACATCTGGAATTAGG - Intergenic
996927069 5:128840297-128840319 TAGCCAATGTGGCTGGTACTTGG - Intronic
998755908 5:145379372-145379394 GAGGCAATGCAGCTGGAATAAGG + Intergenic
1000581663 5:163041411-163041433 TAGTGAATCCTGCTGGGACTGGG - Intergenic
1000939115 5:167338703-167338725 TTGTCAAAGAAGCAGGAACTGGG + Intronic
1002519955 5:179786975-179786997 TGGTCACTGCAGCTGCAACTGGG - Intronic
1008959404 6:57250711-57250733 TACTGAAAGCAACTGGAACTTGG + Intergenic
1013726995 6:113110920-113110942 TAGTAAATGGAGGTGGAAGTGGG + Intergenic
1013954005 6:115819387-115819409 TACTCAATGCTGCTGCAACTGGG - Intergenic
1015154534 6:130077351-130077373 TAGTGATTGCAGCATGAACTTGG + Intronic
1016771404 6:147856280-147856302 TAGTGAATGCAGATGGGAATGGG + Intergenic
1017065407 6:150524213-150524235 TAGTCAATGCAGGTTTACCTTGG + Intergenic
1019487904 7:1297652-1297674 TACACAATGCGCCTGGAACTTGG - Intergenic
1020150247 7:5676480-5676502 TACTCAATGCAGGTGCAGCTCGG - Intronic
1020748576 7:12111217-12111239 CATTCTATTCAGCTGGAACTAGG - Intergenic
1020757499 7:12221735-12221757 TCCTCAATGGAGATGGAACTGGG + Intronic
1022189309 7:28001635-28001657 AAGTCAGTGGGGCTGGAACTTGG + Intronic
1023194307 7:37617584-37617606 TAAACAAAGCAGCTCGAACTGGG - Intergenic
1026416768 7:70189821-70189843 TAGTCAATGTAGCTGGAAATGGG - Intronic
1029400621 7:100343186-100343208 TAGCCAAAGCAACTGGAACTGGG + Intronic
1029857975 7:103538085-103538107 TAGTCAGTGGGGATGGAACTTGG - Intronic
1030976338 7:116128104-116128126 TAGTCAATAAAGTTGAAACTTGG + Intronic
1032451471 7:132035407-132035429 TGGTCAATGCACCTGGGAGTGGG - Intergenic
1034189069 7:149199733-149199755 CAGCTAATGCAGCTGGAATTTGG - Intronic
1038281108 8:26165820-26165842 CAGGCAGTGCAGCAGGAACTGGG - Intergenic
1038929749 8:32179655-32179677 TAGACTGTTCAGCTGGAACTTGG - Intronic
1040738968 8:50548292-50548314 TAGGCAATGCAGCTAGATCCTGG + Intronic
1041696111 8:60738535-60738557 TATACAATGCAGCTGCGACTTGG + Intronic
1043235893 8:77865854-77865876 TAGTCAATGCAGCTTTTATTTGG - Intergenic
1043272380 8:78350980-78351002 TAAACAAAGCAGCTTGAACTGGG + Intergenic
1043861059 8:85317657-85317679 TAATAAATGTAGCTTGAACTTGG + Intergenic
1045275049 8:100696590-100696612 TAGTAAGTGGAGGTGGAACTGGG - Intronic
1045291696 8:100838927-100838949 TACTAAATGCAACTGGAAATTGG - Intergenic
1047531253 8:125678859-125678881 TAGTCAGTGGATCTGGATCTGGG + Intergenic
1048063788 8:130947881-130947903 TAGTCAATCCACCTGTCACTAGG + Intronic
1048969694 8:139638619-139638641 CAGACAAAGCAGCTGGCACTTGG - Intronic
1049560040 8:143305587-143305609 CAGGCCCTGCAGCTGGAACTGGG - Intronic
1049910451 9:261119-261141 TTGTCTATGCAGAGGGAACTGGG + Intronic
1053124927 9:35573371-35573393 TAGTGTATACAGCTTGAACTTGG - Intergenic
1053872954 9:42512926-42512948 TGGTCAATTCAGCTGTTACTGGG + Intergenic
1053899800 9:42782988-42783010 TGGTCAATTCAGCTGTTACTGGG - Intergenic
1054269376 9:62953826-62953848 TGGTCAATTCAGCTGTTACTGGG - Intergenic
1057431034 9:94994240-94994262 TAGTCAATTAAGCTGCAAATGGG + Intronic
1057624768 9:96667470-96667492 CAGCCAAGGCAGCTGGAGCTGGG + Intergenic
1057721667 9:97536471-97536493 TACTCAATGCCCCTGGACCTCGG + Intronic
1059829538 9:118079484-118079506 TAATCAATGCAGCTTGATATTGG + Intergenic
1060766702 9:126299443-126299465 TAGTAAATATAGCTGGAGCTTGG + Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1190373412 X:49764799-49764821 TACTCCATGCACCTGGAGCTGGG + Intergenic
1194324484 X:92496026-92496048 TAGTCAATGCAGTAGGTACTGGG - Intronic
1200633228 Y:5615235-5615257 TAGTCAATGCAGTAGGTACTGGG - Intronic