ID: 1120816807

View in Genome Browser
Species Human (GRCh38)
Location 14:88869462-88869484
Sequence GATTGTTATTCCTCTCCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120816807 Original CRISPR GATTGTTATTCCTCTCCTAA TGG Intronic
902846860 1:19117720-19117742 CATAGATGTTCCTCTCCTAATGG - Intronic
902850179 1:19149179-19149201 GTTTCCTATTCCTTTCCTAAGGG - Intronic
902898051 1:19493017-19493039 GATGGTTCTTCCTTTCCTGAAGG + Intergenic
902913458 1:19619799-19619821 AATTCTTTTTCCTCTCCAAAAGG + Intronic
905176224 1:36137198-36137220 GATGGTTATTCCTCTCCAGCTGG + Exonic
906768982 1:48466212-48466234 AATTTTTGTTCCTCTCTTAATGG - Intronic
909155533 1:72070314-72070336 AATTGAAATTTCTCTCCTAATGG + Intronic
909931005 1:81500455-81500477 GAATGTCATTCCTCTTCAAAAGG + Intronic
912111127 1:106344821-106344843 TGTTCTTATTCTTCTCCTAATGG - Intergenic
913265341 1:117037796-117037818 AATTGTTATTCCTGTCCTACAGG + Intergenic
915016864 1:152742508-152742530 GATAATTATTCCTTTCCTGAAGG - Intronic
915447210 1:155980515-155980537 CCTTGTTATTCATCTCCTAAGGG - Intronic
915639506 1:157212774-157212796 AATTGTTATTCGTCTACTCAGGG + Intergenic
1065364897 10:24925898-24925920 GAATGTTATGCCTCTCACAATGG + Intronic
1067104212 10:43355018-43355040 GACTGTTATCTCTCTCCTGATGG - Intergenic
1068128659 10:52870703-52870725 TATTTTTATTTCTCACCTAATGG - Intergenic
1070433463 10:76364408-76364430 GATTATTATTGCTATCCTAGGGG + Intronic
1070439494 10:76429494-76429516 GATTATTATTCCTCTTGTCAGGG + Intronic
1071135165 10:82445325-82445347 GGATGTCATTCCTCACCTAAAGG + Intronic
1075105199 10:119535201-119535223 GATTGTTCTTGGTCTCTTAAAGG - Intronic
1077576571 11:3387880-3387902 TATTATTATTAATCTCCTAAGGG + Intergenic
1077678419 11:4217874-4217896 AATTGTTTTTCCTCTGCAAATGG - Intergenic
1077682213 11:4252463-4252485 AATTGTTTTTCCTCTGCAAATGG + Intergenic
1077687827 11:4314279-4314301 AATTGTTTTTCCTCTGCAAATGG - Intergenic
1081743297 11:45455934-45455956 GATAGTAATTCCTCTCTCAAAGG - Intergenic
1082658297 11:55877959-55877981 GCTTTTTATTCCTGTCCTATAGG - Intergenic
1086323949 11:85679659-85679681 GATTAGTATTTCTCTCCTAGAGG - Intronic
1086426908 11:86693730-86693752 TATTGCTATTCCAGTCCTAAAGG - Intergenic
1088291578 11:108243750-108243772 TATAGTTATTCCTGTCTTAAAGG + Intronic
1088964436 11:114703809-114703831 GAAAGCTGTTCCTCTCCTAATGG - Intronic
1089601072 11:119615607-119615629 AAAGGTTTTTCCTCTCCTAAAGG - Intergenic
1090903645 11:131054609-131054631 GATTTTTATTCCTCTGCTTGTGG + Intergenic
1097288552 12:57895916-57895938 GATTGTTCATCCTCTCCCACTGG + Intergenic
1098417453 12:70251535-70251557 GCTTTTTTTTCCCCTCCTAATGG - Intronic
1098476272 12:70907856-70907878 GTTTGATAGTCCTCTCTTAATGG - Intronic
1098607269 12:72406534-72406556 GAATTTTTTTCTTCTCCTAAGGG + Intronic
1100832984 12:98535887-98535909 GATTTCTATTCCACTACTAATGG + Intronic
1108283479 13:48882565-48882587 GATTGTAATTCTGCTCCTACTGG - Intergenic
1112100155 13:96179737-96179759 GATTGCTATTCCTAATCTAATGG - Intronic
1114735730 14:25041966-25041988 GATGTTTATTGCTTTCCTAAGGG - Intronic
1115454998 14:33591845-33591867 GATTGTTCTTTCTCTCCTTGTGG - Intronic
1116623834 14:47241075-47241097 GATTGGTCATCCACTCCTAAAGG - Intronic
1116812354 14:49551641-49551663 GATTTTTCTTCATTTCCTAAGGG - Intergenic
1119953969 14:78775128-78775150 TATTTTTATTCCACCCCTAATGG + Intronic
1120816807 14:88869462-88869484 GATTGTTATTCCTCTCCTAATGG + Intronic
1124045277 15:26143572-26143594 GATTATTATTTCTCTGCTCATGG - Intergenic
1129920441 15:79315002-79315024 GATGGTTATTCCTGTCTTACAGG - Intronic
1133014422 16:2932913-2932935 GAGTCTCATTCCTCTCCTAGCGG - Intronic
1137353382 16:47734163-47734185 GATTTTTTTTCCTTTCCAAAAGG + Intergenic
1140887140 16:79254334-79254356 CTTTGTTATTACTCTCCTAGTGG + Intergenic
1144033481 17:11342592-11342614 GGTTGTTACTGCTCTGCTAATGG - Intronic
1146776446 17:35622080-35622102 GATTATTATTTCTCTCTTTATGG + Intronic
1156080430 18:33327625-33327647 TATTTTTAATCCTATCCTAATGG + Intronic
1158369740 18:56786717-56786739 CATTGTGATTCCTATACTAATGG + Intronic
1158547489 18:58408553-58408575 TATTTTTTCTCCTCTCCTAAAGG + Intergenic
930740328 2:54825842-54825864 CATGGTTTTTCCTCTCCTACAGG + Intronic
931047354 2:58370643-58370665 GATAGATGTTCCTCTCCTGAAGG - Intergenic
940660608 2:156540391-156540413 GACCGTTCTTCCTCTCCTATGGG + Intronic
942989810 2:182186508-182186530 AATTGTTATTCCTCTTATAGAGG - Exonic
944434736 2:199675551-199675573 GATTTTTTTTTCTCTCATAAAGG + Intergenic
1170431481 20:16280563-16280585 CATTCTTGTCCCTCTCCTAAGGG - Intronic
1178621206 21:34178011-34178033 CAGTGTTTTTCCTCTCCTATTGG - Intergenic
1180117933 21:45724425-45724447 GCTTGTTCATCCTCTCCCAACGG + Intronic
949460119 3:4282920-4282942 TATTTTTATTGCTCTCCTAAAGG + Intronic
949963314 3:9333143-9333165 GCTTGTTATTACTCTCGGAAAGG + Intronic
951352894 3:21628434-21628456 CATTTTTATTCATTTCCTAAAGG + Intronic
956975201 3:74570904-74570926 GTTTGGTATTCAACTCCTAAGGG + Intergenic
959468369 3:106718733-106718755 TATTGTTTTTCCCCTGCTAAGGG + Intergenic
962508810 3:136077555-136077577 GATTATTTTTCTTCTCCCAAAGG - Intronic
964394656 3:156232984-156233006 GATTATTATACCTCTTCTAGAGG + Intronic
964505421 3:157393843-157393865 GATTGTTTTTCCTATTCTATTGG + Intronic
968492773 4:899324-899346 CATTGTTCTTCCTCTCCAGAGGG - Intronic
971270957 4:25144741-25144763 GAATGTTATTCGACACCTAAAGG + Intronic
975076671 4:70218057-70218079 CATTGTCACTACTCTCCTAAAGG + Intergenic
975514942 4:75236680-75236702 GATTATTATTCTTCTCTCAAAGG + Intergenic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
976670536 4:87647780-87647802 GGTTGTTATTCTGCTCCTATGGG + Intergenic
978170286 4:105661515-105661537 TATTGTTATAGCTATCCTAATGG + Intronic
978905510 4:114001103-114001125 GACTGTTTTTCCTTTCCAAAGGG + Intergenic
985322652 4:188732058-188732080 GAATGTTATCCCACTCATAATGG - Intergenic
985329322 4:188811124-188811146 GATTGTTTTGCCTATCCTCATGG - Intergenic
988675112 5:33425083-33425105 GTCTGTTGTTCCTCTCCTAGTGG + Intergenic
996277905 5:121690373-121690395 TATTTTTATTGCTGTCCTAAAGG - Intergenic
998439421 5:142144463-142144485 CATTGTTATTTTTCTGCTAAAGG - Intronic
998870156 5:146543912-146543934 TATTTTTTTTCCTCTCTTAAGGG + Intergenic
1004745479 6:18504748-18504770 GATTGGTATTTGTCTCTTAAAGG - Intergenic
1005001366 6:21245002-21245024 AATTGTTTTCCCTCTCCTGAAGG - Intergenic
1008880225 6:56374068-56374090 GATTTTTATTGATCTCTTAAGGG + Intronic
1008891501 6:56497734-56497756 TATTTTTACTCCTCTCCTTAAGG + Intronic
1009216436 6:60925910-60925932 CATTGTTATTTTTCTCCAAAGGG - Intergenic
1009334614 6:62471419-62471441 AATTTTTTTTCCTTTCCTAAAGG - Intergenic
1009801121 6:68537626-68537648 AATTGTTATTCCTCTATTCAGGG - Intergenic
1010153417 6:72763645-72763667 TATTGTAATTTCTGTCCTAAAGG + Intronic
1011125855 6:84006793-84006815 CATTGTTATTCCTCTTTTATAGG + Intergenic
1015505651 6:133984354-133984376 GAATTTTACTTCTCTCCTAAAGG + Exonic
1016577483 6:145585322-145585344 AATTTTTTTTACTCTCCTAAGGG + Intronic
1022407003 7:30099843-30099865 GCTAGTTATTCATTTCCTAAGGG + Intronic
1024581178 7:50802335-50802357 CACTGGCATTCCTCTCCTAAGGG - Intergenic
1029101834 7:98137538-98137560 GATTTTTTTTCTTCCCCTAATGG + Intronic
1035430036 7:158812422-158812444 TATTGTTATTGCTGTCCTAGTGG - Intronic
1036200581 8:6768004-6768026 GACTATTATTCCTAACCTAAAGG - Intergenic
1040802398 8:51357748-51357770 GATTTTTATTTTTTTCCTAATGG + Intronic
1041055534 8:53982162-53982184 GATGGTTAATCCTTTCCAAAAGG - Intronic
1048224306 8:132570003-132570025 GATGGTTATTTCTCTTCTAGAGG - Intergenic
1048362248 8:133707871-133707893 GATTGTTATTCCACTGTTCAAGG + Intergenic
1048831169 8:138478776-138478798 GTTTGTTTTTCCCCTCCTTATGG - Intronic
1051013984 9:12452889-12452911 GATTCATATTCCTCTACTATAGG - Intergenic
1052631035 9:31039010-31039032 CATTTTTTTTTCTCTCCTAAGGG - Intergenic
1056721730 9:89077902-89077924 GCTTTTTCTTCCTGTCCTAAGGG - Exonic
1056729396 9:89152273-89152295 GGTTGTTCTTCCTCTCCCAGTGG + Intronic
1059752425 9:117260329-117260351 CACTGTTATTCTTCTTCTAAAGG + Intronic
1186059310 X:5686598-5686620 CATTGTTATTCTTCTCATGAAGG - Intergenic
1197697087 X:129561900-129561922 GGATGTTATTCCTCTCATATAGG + Intronic
1198419199 X:136452136-136452158 GTTTGTGATTCCTCTCAAAAGGG + Intergenic