ID: 1120817306

View in Genome Browser
Species Human (GRCh38)
Location 14:88875580-88875602
Sequence ACGTGGTTCCCTTTAGCTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120817306 Original CRISPR ACGTGGTTCCCTTTAGCTTT CGG (reversed) Intronic
906267934 1:44448619-44448641 ACTTGGTTTCCTTGAGATTTAGG + Intronic
906972754 1:50534245-50534267 TAATGGTTCCCTTTAGCCTTGGG + Intronic
908105886 1:60841911-60841933 AAGTGGTTCACATGAGCTTTGGG + Intergenic
908467485 1:64412096-64412118 AAATTGTTCCCTTTATCTTTAGG + Intergenic
908838553 1:68254407-68254429 GCATAGTTCCCTTCAGCTTTGGG - Intergenic
910005689 1:82393904-82393926 AAGTGGCTCCCTTTAGTTATTGG + Intergenic
913263125 1:117018829-117018851 ACGTGGTACCCTTTAGTTGCTGG - Intronic
922205892 1:223445927-223445949 ACTTGGTTTCCTTTCACTTTTGG - Intergenic
922281042 1:224124521-224124543 AATTTCTTCCCTTTAGCTTTGGG + Intronic
924907599 1:248473153-248473175 TCGTAGTTCACTTTAGCTTGTGG + Intergenic
924916510 1:248574935-248574957 TCGTAGTTCACTTTAGCTTGTGG - Intergenic
1063237305 10:4130418-4130440 ACTCCGTTCCCTTTAGCTTAGGG - Intergenic
1064806476 10:19139823-19139845 ACCTTGTTCCATGTAGCTTTTGG - Intronic
1066222744 10:33351874-33351896 ACATGGTTCTCTTAAGCTTTTGG + Intergenic
1069428976 10:68316204-68316226 ACTTGGTTTCCTTTTGTTTTTGG - Intronic
1074327407 10:112465132-112465154 AAGTGGTTTCTTTTATCTTTTGG - Intronic
1075052576 10:119193755-119193777 ACGGGGTTCCCTGTTCCTTTGGG + Intergenic
1075611136 10:123855581-123855603 ACGTGTCTCCCTGTACCTTTTGG - Intronic
1081407988 11:42720163-42720185 ATGTGGTGCCCTTTAGTATTTGG - Intergenic
1088788211 11:113201434-113201456 ACCTGTTTGCCTTTAGATTTGGG + Intronic
1092200741 12:6581028-6581050 ATGTGGATACCTTTACCTTTGGG + Exonic
1092657573 12:10703128-10703150 ACAAGGTTCCCTCCAGCTTTAGG - Intronic
1098445446 12:70561688-70561710 ACGTGGCTCCCCTCACCTTTAGG + Intronic
1099950650 12:89298758-89298780 TCGTGGTTCCATTTAAGTTTTGG - Intergenic
1105804218 13:23940694-23940716 ACAAGGTGCTCTTTAGCTTTGGG - Intergenic
1106271773 13:28161315-28161337 ATGTCTTTCCCCTTAGCTTTTGG + Intronic
1110236333 13:73221477-73221499 ACGGGCTTCCCATTATCTTTAGG + Intergenic
1112996441 13:105580085-105580107 GCGAGGTTCCCTATTGCTTTTGG - Intergenic
1113274158 13:108709450-108709472 ACGTGGTTCCCTGAAGCTGTAGG - Intronic
1117950482 14:61078572-61078594 AAGTGCTTCTTTTTAGCTTTTGG - Intronic
1120165332 14:81192839-81192861 ATGTGGTTTTCTTTTGCTTTAGG - Exonic
1120817306 14:88875580-88875602 ACGTGGTTCCCTTTAGCTTTCGG - Intronic
1120822952 14:88929909-88929931 ACTTGGGTTCCTTTACCTTTTGG + Intergenic
1124822222 15:33057739-33057761 AAGTGCTTCCCTTTATCTTGGGG + Intronic
1126080293 15:44954412-44954434 TTGTGGTTCCCTTTTTCTTTAGG - Intergenic
1129065611 15:72901537-72901559 ATGTGGTTTCCTTTCCCTTTTGG - Intergenic
1131425110 15:92339704-92339726 ATGTGGTGCCCTTTAGTTATGGG + Intergenic
1138252641 16:55514798-55514820 ACATGGTTTCCTTTAGTTATTGG - Intronic
1141836247 16:86541705-86541727 AGGTGATTCCCATTGGCTTTGGG + Exonic
1142324766 16:89407457-89407479 ACGTGGTTCCTTTTTGGCTTGGG - Intronic
1146021699 17:29284771-29284793 ACCTGGTTCCCTTTAAACTTGGG + Intronic
1147768655 17:42852989-42853011 AAGTTGTTTCCATTAGCTTTGGG + Intronic
1151114426 17:71718004-71718026 ACATGGTTCCCTGTGGTTTTTGG - Intergenic
1153065243 18:1038153-1038175 TTGAGGTTACCTTTAGCTTTGGG + Intergenic
1153142564 18:1990931-1990953 ACATGGTTTGGTTTAGCTTTTGG - Intergenic
1154957750 18:21276014-21276036 TGGTGGTTCCGTTTAGCTTCAGG + Intronic
1156368692 18:36453315-36453337 ACCTGGTTCACTTTAGTGTTGGG - Intronic
1157923299 18:51736220-51736242 ACGTGGTTCCCTTTGTCTCCAGG + Intergenic
925590445 2:5503929-5503951 ACATGTATCACTTTAGCTTTGGG + Intergenic
925864566 2:8215288-8215310 ATGTGGTTTCCTTTGACTTTGGG - Intergenic
929963893 2:46519218-46519240 ACATGGTAGCCTTTAGCTCTGGG + Exonic
933562701 2:83908042-83908064 ACGTGGTTTCCTTTAACTTTAGG + Intergenic
933573140 2:84036797-84036819 AGGTAGTTCCCTTTAGCTGGGGG + Intergenic
939863061 2:147442108-147442130 ACGTGGTGCCCATCAGATTTGGG + Intergenic
941007686 2:160264415-160264437 ATGTGGTTCCCTTTTGCTTCTGG + Intronic
945517615 2:210782539-210782561 GAGTGGTTACCTTTTGCTTTAGG - Intergenic
946475594 2:220003833-220003855 ACGTGGTTATTTTTAGTTTTGGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172825001 20:37774315-37774337 ACGTGGTTCCCATGTGGTTTGGG - Intronic
1179269657 21:39840877-39840899 GCGTCGTTCCCTGGAGCTTTTGG + Intergenic
1181858114 22:25797296-25797318 ATGTGGTTCCCTTTGCCTGTTGG + Intronic
949122921 3:409240-409262 ACGTGATTACCTTTTTCTTTTGG + Exonic
955181556 3:56675619-56675641 AAGTGGTTCCTTTTTGATTTGGG - Intronic
960246158 3:115402722-115402744 AAGTGGCTCTCTTTAGCTTAAGG + Intergenic
960841984 3:121968446-121968468 TCTTGGTTGCCTTTAACTTTTGG + Intergenic
962481481 3:135801969-135801991 ACCTGGTACCCTTTCACTTTGGG - Intergenic
964941757 3:162166303-162166325 GAGTGGATCCCTTTAGCTTGGGG + Intergenic
970381411 4:15511576-15511598 ACATGGCTCCCTGTAGCTCTGGG + Intronic
971912720 4:32815191-32815213 AGGTGGTTCCCTTATACTTTTGG - Intergenic
972727264 4:41755915-41755937 AAGTAGTTCAGTTTAGCTTTTGG + Intergenic
975833498 4:78395746-78395768 AAGAGATTCACTTTAGCTTTAGG - Intronic
979784286 4:124695770-124695792 ATGTGGTTCTCTTAAGCTTTTGG - Intronic
980212841 4:129812032-129812054 ACCTGGTACCCTCTGGCTTTGGG - Intergenic
985710922 5:1429372-1429394 ACGTGGTACACTTTAGCTGGCGG - Intronic
987239639 5:15981966-15981988 ACTTGCATCCCTTTATCTTTTGG - Intergenic
990757974 5:59096820-59096842 ATGTGGTTCCCATGAGGTTTAGG - Intronic
991993547 5:72365081-72365103 ATGTGGTTCCCTTTCCCTCTGGG - Intergenic
994732080 5:103504250-103504272 ACGTGTTTCGTTTAAGCTTTGGG - Intergenic
996954351 5:129164825-129164847 ACGTATTTCCCTGAAGCTTTTGG + Intergenic
997661169 5:135590558-135590580 ACCTGGTTCCCTTAAGCTCGGGG + Intergenic
999832106 5:155330561-155330583 ACTTAGTTCCCTTTAGTCTTTGG + Intergenic
1003571963 6:7261773-7261795 ATGTGGTTCCCTGTTGCTTGAGG - Intergenic
1010505974 6:76660090-76660112 ATTTGGTTCCCTTTAGATATGGG + Intergenic
1011649403 6:89492002-89492024 ACATGTTTCCCTATTGCTTTGGG + Intronic
1012553083 6:100482034-100482056 GCGGGGTTCCCTTCAGCTTCTGG + Intergenic
1014272024 6:119347142-119347164 ACTTGGATCCCTTTCGGTTTAGG - Intronic
1014358621 6:120445564-120445586 ACCTGTTTCACTTTATCTTTTGG - Intergenic
1018799164 6:167209535-167209557 AGGTGGTTGCCTTAAGGTTTGGG + Intergenic
1024358015 7:48437538-48437560 CCATGTTTTCCTTTAGCTTTTGG + Intronic
1025255125 7:57379506-57379528 ACTTGTTTCCCTTTAGCTCTTGG - Intergenic
1030447648 7:109667387-109667409 AGATGGTTCCATTTATCTTTGGG + Intergenic
1030878123 7:114841605-114841627 ACAAGTTTCCCTTTATCTTTGGG - Intergenic
1034473190 7:151267146-151267168 AAGTGTTTCCCTATATCTTTAGG - Intronic
1037257177 8:16968594-16968616 CAGTGGTTTCCTTTAGCTGTGGG + Intergenic
1040895071 8:52358319-52358341 CTGTGGTTCCTTCTAGCTTTGGG - Intronic
1047192222 8:122688496-122688518 ACTGGCTTCCCTTTAGCTTCAGG - Intergenic
1053575515 9:39355384-39355406 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1053840021 9:42183323-42183345 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1054097075 9:60914071-60914093 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1054118482 9:61189700-61189722 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1054589274 9:66992864-66992886 ACCTGGTTCCTTTTATCTGTTGG + Intergenic
1055987270 9:82063983-82064005 ACCTGGTTCCTTTTATCTGTTGG + Intergenic
1056583641 9:87914216-87914238 ACCTGGTTCCTTTTATCTATTGG - Intergenic
1056584133 9:87917685-87917707 ACCTGGTTCCTTTTATCTATTGG - Intergenic
1056612735 9:88135240-88135262 ACCTGGTTCCTTTTATCTATTGG + Intergenic
1056613233 9:88138730-88138752 ACCTGGTTCCTTTTATCTGTTGG + Intergenic
1057159907 9:92882297-92882319 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1187856000 X:23636761-23636783 ACTTGGCTCCCTTTGTCTTTGGG - Intergenic
1191956190 X:66644771-66644793 AAGTGGTCCCCTGTAGCTTTAGG - Intergenic
1192862599 X:75093143-75093165 TCTTGGTTTCCTTTAGATTTTGG - Intronic
1197094410 X:122575710-122575732 TCCTGCTTCCCTTTTGCTTTTGG - Intergenic
1197096170 X:122598373-122598395 TCCTGGTTCCTTTTAGTTTTTGG - Intergenic
1197191333 X:123650720-123650742 ACGTTGATCCCTTTACCATTAGG - Intronic