ID: 1120818095

View in Genome Browser
Species Human (GRCh38)
Location 14:88884140-88884162
Sequence TCCACATGGTGTTGGTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120818095_1120818101 -5 Left 1120818095 14:88884140-88884162 CCTGCAAACCAACACCATGTGGA No data
Right 1120818101 14:88884158-88884180 GTGGAAGCTGCCAAGGATTGGGG No data
1120818095_1120818099 -7 Left 1120818095 14:88884140-88884162 CCTGCAAACCAACACCATGTGGA No data
Right 1120818099 14:88884156-88884178 ATGTGGAAGCTGCCAAGGATTGG No data
1120818095_1120818103 17 Left 1120818095 14:88884140-88884162 CCTGCAAACCAACACCATGTGGA No data
Right 1120818103 14:88884180-88884202 GCTTGCACCCTCTGAAGCAATGG 0: 267
1: 850
2: 995
3: 793
4: 625
1120818095_1120818100 -6 Left 1120818095 14:88884140-88884162 CCTGCAAACCAACACCATGTGGA No data
Right 1120818100 14:88884157-88884179 TGTGGAAGCTGCCAAGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120818095 Original CRISPR TCCACATGGTGTTGGTTTGC AGG (reversed) Intergenic
No off target data available for this crispr