ID: 1120820339

View in Genome Browser
Species Human (GRCh38)
Location 14:88906295-88906317
Sequence TTTGCCTCACAGTACTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120820330_1120820339 20 Left 1120820330 14:88906252-88906274 CCCAGAAATGCAGGGGCATTGTC No data
Right 1120820339 14:88906295-88906317 TTTGCCTCACAGTACTAGGTAGG No data
1120820329_1120820339 21 Left 1120820329 14:88906251-88906273 CCCCAGAAATGCAGGGGCATTGT No data
Right 1120820339 14:88906295-88906317 TTTGCCTCACAGTACTAGGTAGG No data
1120820331_1120820339 19 Left 1120820331 14:88906253-88906275 CCAGAAATGCAGGGGCATTGTCT No data
Right 1120820339 14:88906295-88906317 TTTGCCTCACAGTACTAGGTAGG No data
1120820333_1120820339 -8 Left 1120820333 14:88906280-88906302 CCCTGCTATATCCCCTTTGCCTC No data
Right 1120820339 14:88906295-88906317 TTTGCCTCACAGTACTAGGTAGG No data
1120820334_1120820339 -9 Left 1120820334 14:88906281-88906303 CCTGCTATATCCCCTTTGCCTCA No data
Right 1120820339 14:88906295-88906317 TTTGCCTCACAGTACTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120820339 Original CRISPR TTTGCCTCACAGTACTAGGT AGG Intergenic
No off target data available for this crispr