ID: 1120820790

View in Genome Browser
Species Human (GRCh38)
Location 14:88910244-88910266
Sequence CTGTGGAAGGGGAAAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120820790_1120820802 27 Left 1120820790 14:88910244-88910266 CCAGCCACTTTCCCCTTCCACAG No data
Right 1120820802 14:88910294-88910316 TAGCATCCTATGATTTCTATGGG No data
1120820790_1120820801 26 Left 1120820790 14:88910244-88910266 CCAGCCACTTTCCCCTTCCACAG No data
Right 1120820801 14:88910293-88910315 ATAGCATCCTATGATTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120820790 Original CRISPR CTGTGGAAGGGGAAAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr