ID: 1120821394

View in Genome Browser
Species Human (GRCh38)
Location 14:88914887-88914909
Sequence GGGTTTAAAAATATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120821394_1120821403 20 Left 1120821394 14:88914887-88914909 CCCTGCCCCATATTTTTAAACCC No data
Right 1120821403 14:88914930-88914952 TCTAGTCAAGATGCTGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120821394 Original CRISPR GGGTTTAAAAATATGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr