ID: 1120822069

View in Genome Browser
Species Human (GRCh38)
Location 14:88921178-88921200
Sequence TTTGCTTTTATTCACATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120822069_1120822075 30 Left 1120822069 14:88921178-88921200 CCTGTAATGTGAATAAAAGCAAA No data
Right 1120822075 14:88921231-88921253 AGCTATTTGTTACACAGCAAAGG No data
1120822069_1120822070 7 Left 1120822069 14:88921178-88921200 CCTGTAATGTGAATAAAAGCAAA No data
Right 1120822070 14:88921208-88921230 ATTGTAACCCATTAAGATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120822069 Original CRISPR TTTGCTTTTATTCACATTAC AGG (reversed) Intergenic