ID: 1120822071

View in Genome Browser
Species Human (GRCh38)
Location 14:88921215-88921237
Sequence AATAGCTCCGGGATCTTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120822071_1120822075 -7 Left 1120822071 14:88921215-88921237 CCCATTAAGATCCCGGAGCTATT No data
Right 1120822075 14:88921231-88921253 AGCTATTTGTTACACAGCAAAGG No data
1120822071_1120822076 26 Left 1120822071 14:88921215-88921237 CCCATTAAGATCCCGGAGCTATT No data
Right 1120822076 14:88921264-88921286 CAAAATATTTATGTATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120822071 Original CRISPR AATAGCTCCGGGATCTTAAT GGG (reversed) Intergenic