ID: 1120822072

View in Genome Browser
Species Human (GRCh38)
Location 14:88921216-88921238
Sequence AAATAGCTCCGGGATCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120822072_1120822076 25 Left 1120822072 14:88921216-88921238 CCATTAAGATCCCGGAGCTATTT No data
Right 1120822076 14:88921264-88921286 CAAAATATTTATGTATGTGAAGG No data
1120822072_1120822075 -8 Left 1120822072 14:88921216-88921238 CCATTAAGATCCCGGAGCTATTT No data
Right 1120822075 14:88921231-88921253 AGCTATTTGTTACACAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120822072 Original CRISPR AAATAGCTCCGGGATCTTAA TGG (reversed) Intergenic