ID: 1120822075

View in Genome Browser
Species Human (GRCh38)
Location 14:88921231-88921253
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120822072_1120822075 -8 Left 1120822072 14:88921216-88921238 CCATTAAGATCCCGGAGCTATTT No data
Right 1120822075 14:88921231-88921253 AGCTATTTGTTACACAGCAAAGG No data
1120822069_1120822075 30 Left 1120822069 14:88921178-88921200 CCTGTAATGTGAATAAAAGCAAA No data
Right 1120822075 14:88921231-88921253 AGCTATTTGTTACACAGCAAAGG No data
1120822071_1120822075 -7 Left 1120822071 14:88921215-88921237 CCCATTAAGATCCCGGAGCTATT No data
Right 1120822075 14:88921231-88921253 AGCTATTTGTTACACAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120822075 Original CRISPR AGCTATTTGTTACACAGCAA AGG Intergenic