ID: 1120822076

View in Genome Browser
Species Human (GRCh38)
Location 14:88921264-88921286
Sequence CAAAATATTTATGTATGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120822073_1120822076 15 Left 1120822073 14:88921226-88921248 CCCGGAGCTATTTGTTACACAGC No data
Right 1120822076 14:88921264-88921286 CAAAATATTTATGTATGTGAAGG No data
1120822074_1120822076 14 Left 1120822074 14:88921227-88921249 CCGGAGCTATTTGTTACACAGCA No data
Right 1120822076 14:88921264-88921286 CAAAATATTTATGTATGTGAAGG No data
1120822071_1120822076 26 Left 1120822071 14:88921215-88921237 CCCATTAAGATCCCGGAGCTATT No data
Right 1120822076 14:88921264-88921286 CAAAATATTTATGTATGTGAAGG No data
1120822072_1120822076 25 Left 1120822072 14:88921216-88921238 CCATTAAGATCCCGGAGCTATTT No data
Right 1120822076 14:88921264-88921286 CAAAATATTTATGTATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120822076 Original CRISPR CAAAATATTTATGTATGTGA AGG Intergenic