ID: 1120822267

View in Genome Browser
Species Human (GRCh38)
Location 14:88922921-88922943
Sequence AATAACTAAGAGAGTATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3225
Summary {0: 4, 1: 109, 2: 564, 3: 1103, 4: 1445}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120822267 Original CRISPR AATAACTAAGAGAGTATAAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr