ID: 1120824508

View in Genome Browser
Species Human (GRCh38)
Location 14:88943276-88943298
Sequence CAGGGCAGACTCATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120824508_1120824513 17 Left 1120824508 14:88943276-88943298 CCCTTCTCCATGAGTCTGCCCTG No data
Right 1120824513 14:88943316-88943338 TGCAAACTGCTCTCTGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120824508 Original CRISPR CAGGGCAGACTCATGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr