ID: 1120825117

View in Genome Browser
Species Human (GRCh38)
Location 14:88948028-88948050
Sequence CCTTATATGCACAGGCACAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120825113_1120825117 9 Left 1120825113 14:88947996-88948018 CCTCAGCAGTCGGGAGCTGGAGT No data
Right 1120825117 14:88948028-88948050 CCTTATATGCACAGGCACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120825117 Original CRISPR CCTTATATGCACAGGCACAC CGG Intergenic
No off target data available for this crispr