ID: 1120825709

View in Genome Browser
Species Human (GRCh38)
Location 14:88953076-88953098
Sequence CTGGCCGATGAAGCCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120825704_1120825709 11 Left 1120825704 14:88953042-88953064 CCAGGACTTAATCATGCCTGGCA No data
Right 1120825709 14:88953076-88953098 CTGGCCGATGAAGCCTTTGTTGG No data
1120825702_1120825709 16 Left 1120825702 14:88953037-88953059 CCAGTCCAGGACTTAATCATGCC No data
Right 1120825709 14:88953076-88953098 CTGGCCGATGAAGCCTTTGTTGG No data
1120825700_1120825709 29 Left 1120825700 14:88953024-88953046 CCATTAAGCTGAGCCAGTCCAGG No data
Right 1120825709 14:88953076-88953098 CTGGCCGATGAAGCCTTTGTTGG No data
1120825706_1120825709 -5 Left 1120825706 14:88953058-88953080 CCTGGCATCAAAGTCTCCCTGGC No data
Right 1120825709 14:88953076-88953098 CTGGCCGATGAAGCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120825709 Original CRISPR CTGGCCGATGAAGCCTTTGT TGG Intergenic
No off target data available for this crispr