ID: 1120827810

View in Genome Browser
Species Human (GRCh38)
Location 14:88970885-88970907
Sequence GATGCTGCTGCTCCTCCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120827810_1120827814 -3 Left 1120827810 14:88970885-88970907 CCTATTGGAGGAGCAGCAGCATC No data
Right 1120827814 14:88970905-88970927 ATCTGGTCAGGGAAAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120827810 Original CRISPR GATGCTGCTGCTCCTCCAAT AGG (reversed) Intergenic
No off target data available for this crispr