ID: 1120831489

View in Genome Browser
Species Human (GRCh38)
Location 14:89001230-89001252
Sequence TATTGTTGTCCCTCATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120831485_1120831489 12 Left 1120831485 14:89001195-89001217 CCTAACACTTAATGGTTTAAAAC No data
Right 1120831489 14:89001230-89001252 TATTGTTGTCCCTCATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120831489 Original CRISPR TATTGTTGTCCCTCATTTGG GGG Intergenic
No off target data available for this crispr