ID: 1120835558

View in Genome Browser
Species Human (GRCh38)
Location 14:89035744-89035766
Sequence GCCCCACTCCATCGCCGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120835553_1120835558 29 Left 1120835553 14:89035692-89035714 CCAGTGGCACTCAGATTTATACT No data
Right 1120835558 14:89035744-89035766 GCCCCACTCCATCGCCGGGTAGG No data
1120835555_1120835558 1 Left 1120835555 14:89035720-89035742 CCTGAAGTGGTACTTTTCAAGAC No data
Right 1120835558 14:89035744-89035766 GCCCCACTCCATCGCCGGGTAGG No data
1120835552_1120835558 30 Left 1120835552 14:89035691-89035713 CCCAGTGGCACTCAGATTTATAC No data
Right 1120835558 14:89035744-89035766 GCCCCACTCCATCGCCGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120835558 Original CRISPR GCCCCACTCCATCGCCGGGT AGG Intergenic
No off target data available for this crispr