ID: 1120836446

View in Genome Browser
Species Human (GRCh38)
Location 14:89042096-89042118
Sequence ACTCCCTTCTGCCCAGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120836446_1120836447 3 Left 1120836446 14:89042096-89042118 CCTGTAGCTGGGCAGAAGGGAGT No data
Right 1120836447 14:89042122-89042144 TCTTTCTGCAGTTCTTTAGTAGG No data
1120836446_1120836449 26 Left 1120836446 14:89042096-89042118 CCTGTAGCTGGGCAGAAGGGAGT No data
Right 1120836449 14:89042145-89042167 CTTCTTCCAGGATAGTAGAGAGG No data
1120836446_1120836448 14 Left 1120836446 14:89042096-89042118 CCTGTAGCTGGGCAGAAGGGAGT No data
Right 1120836448 14:89042133-89042155 TTCTTTAGTAGGCTTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120836446 Original CRISPR ACTCCCTTCTGCCCAGCTAC AGG (reversed) Intergenic
No off target data available for this crispr