ID: 1120837908

View in Genome Browser
Species Human (GRCh38)
Location 14:89057584-89057606
Sequence TGGGCTGACCCCTGTACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120837899_1120837908 27 Left 1120837899 14:89057534-89057556 CCACGTTGCTGTTGGGGGCTTTT No data
Right 1120837908 14:89057584-89057606 TGGGCTGACCCCTGTACCACAGG No data
1120837903_1120837908 -8 Left 1120837903 14:89057569-89057591 CCCGAGTGCCCACCATGGGCTGA No data
Right 1120837908 14:89057584-89057606 TGGGCTGACCCCTGTACCACAGG No data
1120837904_1120837908 -9 Left 1120837904 14:89057570-89057592 CCGAGTGCCCACCATGGGCTGAC No data
Right 1120837908 14:89057584-89057606 TGGGCTGACCCCTGTACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120837908 Original CRISPR TGGGCTGACCCCTGTACCAC AGG Intergenic
No off target data available for this crispr