ID: 1120838386

View in Genome Browser
Species Human (GRCh38)
Location 14:89061483-89061505
Sequence ATTTGCTGGGGACACACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120838386_1120838393 21 Left 1120838386 14:89061483-89061505 CCAAAAGTGTGTCCCCAGCAAAT No data
Right 1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG No data
1120838386_1120838392 17 Left 1120838386 14:89061483-89061505 CCAAAAGTGTGTCCCCAGCAAAT No data
Right 1120838392 14:89061523-89061545 AAAAACTTCTCTGCAAAGGGTGG No data
1120838386_1120838390 13 Left 1120838386 14:89061483-89061505 CCAAAAGTGTGTCCCCAGCAAAT No data
Right 1120838390 14:89061519-89061541 GCAGAAAAACTTCTCTGCAAAGG No data
1120838386_1120838391 14 Left 1120838386 14:89061483-89061505 CCAAAAGTGTGTCCCCAGCAAAT No data
Right 1120838391 14:89061520-89061542 CAGAAAAACTTCTCTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120838386 Original CRISPR ATTTGCTGGGGACACACTTT TGG (reversed) Intergenic
No off target data available for this crispr