ID: 1120838387

View in Genome Browser
Species Human (GRCh38)
Location 14:89061495-89061517
Sequence CAGTGCACATCAATTTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120838387_1120838393 9 Left 1120838387 14:89061495-89061517 CCCCAGCAAATTGATGTGCACTG No data
Right 1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG No data
1120838387_1120838392 5 Left 1120838387 14:89061495-89061517 CCCCAGCAAATTGATGTGCACTG No data
Right 1120838392 14:89061523-89061545 AAAAACTTCTCTGCAAAGGGTGG No data
1120838387_1120838391 2 Left 1120838387 14:89061495-89061517 CCCCAGCAAATTGATGTGCACTG No data
Right 1120838391 14:89061520-89061542 CAGAAAAACTTCTCTGCAAAGGG No data
1120838387_1120838394 21 Left 1120838387 14:89061495-89061517 CCCCAGCAAATTGATGTGCACTG No data
Right 1120838394 14:89061539-89061561 AGGGTGGCTGGAATTCTGTCAGG No data
1120838387_1120838390 1 Left 1120838387 14:89061495-89061517 CCCCAGCAAATTGATGTGCACTG No data
Right 1120838390 14:89061519-89061541 GCAGAAAAACTTCTCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120838387 Original CRISPR CAGTGCACATCAATTTGCTG GGG (reversed) Intergenic
No off target data available for this crispr