ID: 1120838393

View in Genome Browser
Species Human (GRCh38)
Location 14:89061527-89061549
Sequence ACTTCTCTGCAAAGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120838386_1120838393 21 Left 1120838386 14:89061483-89061505 CCAAAAGTGTGTCCCCAGCAAAT No data
Right 1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG No data
1120838388_1120838393 8 Left 1120838388 14:89061496-89061518 CCCAGCAAATTGATGTGCACTGT No data
Right 1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG No data
1120838385_1120838393 29 Left 1120838385 14:89061475-89061497 CCAGGAGTCCAAAAGTGTGTCCC No data
Right 1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG No data
1120838389_1120838393 7 Left 1120838389 14:89061497-89061519 CCAGCAAATTGATGTGCACTGTG No data
Right 1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG No data
1120838387_1120838393 9 Left 1120838387 14:89061495-89061517 CCCCAGCAAATTGATGTGCACTG No data
Right 1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120838393 Original CRISPR ACTTCTCTGCAAAGGGTGGC TGG Intergenic
No off target data available for this crispr