ID: 1120840111

View in Genome Browser
Species Human (GRCh38)
Location 14:89078205-89078227
Sequence TGTGAGTGCCTGGAGCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120840111_1120840117 9 Left 1120840111 14:89078205-89078227 CCACGTGGCTCCAGGCACTCACA No data
Right 1120840117 14:89078237-89078259 AGGTCCCATCCGCAGGCCTCCGG No data
1120840111_1120840118 10 Left 1120840111 14:89078205-89078227 CCACGTGGCTCCAGGCACTCACA No data
Right 1120840118 14:89078238-89078260 GGTCCCATCCGCAGGCCTCCGGG No data
1120840111_1120840114 2 Left 1120840111 14:89078205-89078227 CCACGTGGCTCCAGGCACTCACA No data
Right 1120840114 14:89078230-89078252 TTCCTCCAGGTCCCATCCGCAGG No data
1120840111_1120840122 23 Left 1120840111 14:89078205-89078227 CCACGTGGCTCCAGGCACTCACA No data
Right 1120840122 14:89078251-89078273 GGCCTCCGGGACGCCTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120840111 Original CRISPR TGTGAGTGCCTGGAGCCACG TGG (reversed) Intergenic
No off target data available for this crispr