ID: 1120840115

View in Genome Browser
Species Human (GRCh38)
Location 14:89078232-89078254
Sequence GGCCTGCGGATGGGACCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120840115_1120840122 -4 Left 1120840115 14:89078232-89078254 CCTCCAGGTCCCATCCGCAGGCC No data
Right 1120840122 14:89078251-89078273 GGCCTCCGGGACGCCTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120840115 Original CRISPR GGCCTGCGGATGGGACCTGG AGG (reversed) Intergenic
No off target data available for this crispr