ID: 1120840116

View in Genome Browser
Species Human (GRCh38)
Location 14:89078235-89078257
Sequence GGAGGCCTGCGGATGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120840116_1120840122 -7 Left 1120840116 14:89078235-89078257 CCAGGTCCCATCCGCAGGCCTCC No data
Right 1120840122 14:89078251-89078273 GGCCTCCGGGACGCCTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120840116 Original CRISPR GGAGGCCTGCGGATGGGACC TGG (reversed) Intergenic
No off target data available for this crispr