ID: 1120840117

View in Genome Browser
Species Human (GRCh38)
Location 14:89078237-89078259
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120840109_1120840117 18 Left 1120840109 14:89078196-89078218 CCAGTTTATCCACGTGGCTCCAG No data
Right 1120840117 14:89078237-89078259 AGGTCCCATCCGCAGGCCTCCGG No data
1120840105_1120840117 29 Left 1120840105 14:89078185-89078207 CCAGATGTGCCCCAGTTTATCCA No data
Right 1120840117 14:89078237-89078259 AGGTCCCATCCGCAGGCCTCCGG No data
1120840108_1120840117 19 Left 1120840108 14:89078195-89078217 CCCAGTTTATCCACGTGGCTCCA No data
Right 1120840117 14:89078237-89078259 AGGTCCCATCCGCAGGCCTCCGG No data
1120840111_1120840117 9 Left 1120840111 14:89078205-89078227 CCACGTGGCTCCAGGCACTCACA No data
Right 1120840117 14:89078237-89078259 AGGTCCCATCCGCAGGCCTCCGG No data
1120840112_1120840117 -1 Left 1120840112 14:89078215-89078237 CCAGGCACTCACATGTTCCTCCA No data
Right 1120840117 14:89078237-89078259 AGGTCCCATCCGCAGGCCTCCGG No data
1120840107_1120840117 20 Left 1120840107 14:89078194-89078216 CCCCAGTTTATCCACGTGGCTCC No data
Right 1120840117 14:89078237-89078259 AGGTCCCATCCGCAGGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120840117 Original CRISPR AGGTCCCATCCGCAGGCCTC CGG Intergenic
No off target data available for this crispr