ID: 1120842385

View in Genome Browser
Species Human (GRCh38)
Location 14:89097279-89097301
Sequence GTTCCACCCGAGCCAGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120842382_1120842385 14 Left 1120842382 14:89097242-89097264 CCACAGACACACGTGTGTCAGGT No data
Right 1120842385 14:89097279-89097301 GTTCCACCCGAGCCAGGTGAAGG No data
1120842380_1120842385 30 Left 1120842380 14:89097226-89097248 CCAGCTCGGCTTGTGGCCACAGA No data
Right 1120842385 14:89097279-89097301 GTTCCACCCGAGCCAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120842385 Original CRISPR GTTCCACCCGAGCCAGGTGA AGG Intergenic
No off target data available for this crispr