ID: 1120844145

View in Genome Browser
Species Human (GRCh38)
Location 14:89111729-89111751
Sequence CGGCCGGCTGTTCCGAGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120844145_1120844162 17 Left 1120844145 14:89111729-89111751 CCCGCACTCGGAACAGCCGGCCG No data
Right 1120844162 14:89111769-89111791 CAATGAGGGACTTAGCACCCGGG 0: 165
1: 442
2: 582
3: 703
4: 375
1120844145_1120844155 2 Left 1120844145 14:89111729-89111751 CCCGCACTCGGAACAGCCGGCCG No data
Right 1120844155 14:89111754-89111776 CCTGCCGGCCCCGGGCAATGAGG 0: 130
1: 358
2: 297
3: 245
4: 413
1120844145_1120844151 -6 Left 1120844145 14:89111729-89111751 CCCGCACTCGGAACAGCCGGCCG No data
Right 1120844151 14:89111746-89111768 CGGCCGGCCCTGCCGGCCCCGGG 0: 86
1: 235
2: 294
3: 363
4: 690
1120844145_1120844163 24 Left 1120844145 14:89111729-89111751 CCCGCACTCGGAACAGCCGGCCG No data
Right 1120844163 14:89111776-89111798 GGACTTAGCACCCGGGCCAGCGG 0: 199
1: 372
2: 239
3: 74
4: 97
1120844145_1120844150 -7 Left 1120844145 14:89111729-89111751 CCCGCACTCGGAACAGCCGGCCG No data
Right 1120844150 14:89111745-89111767 CCGGCCGGCCCTGCCGGCCCCGG 0: 95
1: 229
2: 278
3: 371
4: 724
1120844145_1120844156 3 Left 1120844145 14:89111729-89111751 CCCGCACTCGGAACAGCCGGCCG No data
Right 1120844156 14:89111755-89111777 CTGCCGGCCCCGGGCAATGAGGG 0: 136
1: 318
2: 344
3: 293
4: 423
1120844145_1120844161 16 Left 1120844145 14:89111729-89111751 CCCGCACTCGGAACAGCCGGCCG No data
Right 1120844161 14:89111768-89111790 GCAATGAGGGACTTAGCACCCGG 0: 167
1: 435
2: 766
3: 402
4: 200
1120844145_1120844164 30 Left 1120844145 14:89111729-89111751 CCCGCACTCGGAACAGCCGGCCG No data
Right 1120844164 14:89111782-89111804 AGCACCCGGGCCAGCGGCTGCGG 0: 236
1: 507
2: 438
3: 199
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120844145 Original CRISPR CGGCCGGCTGTTCCGAGTGC GGG (reversed) Intergenic
No off target data available for this crispr