ID: 1120847595

View in Genome Browser
Species Human (GRCh38)
Location 14:89139608-89139630
Sequence ACCTGTGTGGAGAGCTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120847590_1120847595 1 Left 1120847590 14:89139584-89139606 CCTGCAGGTGAGAGAGAGCCTGG 0: 1
1: 0
2: 6
3: 50
4: 427
Right 1120847595 14:89139608-89139630 ACCTGTGTGGAGAGCTTCTCAGG 0: 1
1: 0
2: 1
3: 17
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120847595 Original CRISPR ACCTGTGTGGAGAGCTTCTC AGG Intronic
900458268 1:2787705-2787727 CCCTGTGTGGAGATCAGCTCAGG + Exonic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901067757 1:6502504-6502526 AGCTGTGTGGACAGTTTCTTGGG - Intronic
901912511 1:12471714-12471736 ACCTGGGTGGGGGGCTTCACTGG - Intronic
903069482 1:20719961-20719983 ACCTGTGTGGAGAAGCTATCAGG - Intronic
904501359 1:30914615-30914637 ACCTGGGAGGAGAGCCTCTAAGG + Intergenic
905792610 1:40798274-40798296 ACCTTTCTGCAGAGCTTCCCAGG + Intronic
906303514 1:44701182-44701204 GCCTGTGTGGAGAGCAACTGCGG - Intronic
907668059 1:56450507-56450529 ACCTGTGTGGAGTGCATTCCTGG - Intergenic
908938471 1:69403870-69403892 ACCTGTGTGGAGAGAATGTTTGG - Intergenic
911617180 1:100027325-100027347 ACCTGTGGGGCCAGCTACTCAGG + Intergenic
912559168 1:110537943-110537965 ACCTGTGTGGAGGGCATAGCAGG - Intergenic
912859026 1:113196550-113196572 TCTTGTGTGGAGAGGTTCCCTGG - Intergenic
913298262 1:117343493-117343515 ACCTGTGAGGAAAGGTGCTCTGG - Intergenic
914338851 1:146740995-146741017 ACCTTTGTGGATAGATTTTCTGG - Intergenic
914900501 1:151708911-151708933 TCCTGAGTGGACTGCTTCTCTGG + Intronic
915980178 1:160415512-160415534 ACCTGGGTGGAGATATTCTCAGG + Intronic
916582492 1:166121392-166121414 ACCTGTGTGGACACTTTCCCTGG - Intronic
917441623 1:175073804-175073826 TCCTTTGTGGGGAGCTTCTGTGG + Intronic
918807792 1:189071953-189071975 ACTTCTGTGGAGAGGTTTTCTGG - Intergenic
919522901 1:198611285-198611307 ACCTTTGTGGAGAGAATTTCTGG - Intergenic
922244017 1:223777263-223777285 TCCAGTGTGGACAGCTTCTCCGG - Intergenic
922376491 1:224973076-224973098 ACTTATGTGGAGTGCTTCTTTGG + Intronic
922686366 1:227641508-227641530 ACCATTGTGGAGAGTTTTTCTGG + Intronic
923170834 1:231415695-231415717 ACCTGTGTTTTTAGCTTCTCAGG - Intronic
1064006131 10:11700593-11700615 GCCTGTGTGCAAAGCTCCTCTGG - Intergenic
1064187574 10:13175647-13175669 ATCTGTGTGGAAGCCTTCTCTGG + Exonic
1064681949 10:17819081-17819103 ACCTTTATGGAGAGGTTTTCTGG - Intronic
1067048509 10:42999237-42999259 ACCTTTCTCGGGAGCTTCTCAGG + Intergenic
1067238770 10:44473008-44473030 ACCTGTGTGGAGAGCAGGCCAGG + Intergenic
1067719302 10:48715085-48715107 ACCTGTGTGGAGAGGATCCAAGG + Intronic
1069106821 10:64393445-64393467 ACCTTTGTGCAGAGGTTTTCTGG - Intergenic
1069344151 10:67447419-67447441 ACCTTTGTGAAGAGCATATCTGG + Intronic
1071017934 10:81020548-81020570 AGCAGTGCGGAGAGCATCTCTGG + Intergenic
1072718250 10:97765667-97765689 ACCGGTGGGGAGAGCCCCTCAGG + Intergenic
1076394270 10:130127163-130127185 ACCTGAGTATAGAACTTCTCAGG + Intergenic
1077656447 11:4023804-4023826 ACCTGTGTGGAGATCTTGACGGG + Intronic
1079357924 11:19745461-19745483 AGGTGTGTGGAGGGCTACTCTGG - Intronic
1079928192 11:26522743-26522765 ATCTTTGTGGAGAGGTTTTCTGG - Intronic
1082952774 11:58835149-58835171 AGCCATGTGGAGGGCTTCTCTGG - Intronic
1083301087 11:61739919-61739941 ACCAGTGGGGAGAGCTGCCCTGG - Intronic
1084630330 11:70344153-70344175 AGCTATGTGGCGAGCTTCTCAGG - Intronic
1086879940 11:92141234-92141256 ACCTGTGTGGACAGACTCACAGG - Intergenic
1087201202 11:95346407-95346429 CCTGGTGTGGAGAGCCTCTCTGG + Intergenic
1096001987 12:48137781-48137803 GCCTGTGTAGTGAGCCTCTCTGG + Exonic
1098373066 12:69780477-69780499 ACCTGTGCAGGGAGCTTCTAGGG - Intronic
1102403682 12:112653406-112653428 ACCTGTATAGAGAGCTTACCAGG + Intronic
1103716092 12:122946206-122946228 ACCTCTTTGGAGAGCCTCTATGG + Exonic
1105323374 13:19347877-19347899 CCCTGTGGGGAGAGTTGCTCAGG - Intergenic
1106212476 13:27663057-27663079 ATCAGTGGGGAGAGCTTCTCTGG - Intronic
1106365494 13:29075268-29075290 ACGTGTGTTCAGAGCTGCTCTGG - Intronic
1107683878 13:42877658-42877680 ACCTTTGTAGAAAGCTTTTCTGG - Intergenic
1107943512 13:45396356-45396378 GCCTTTGAGGAGAGCTTCCCAGG - Intronic
1108151518 13:47540767-47540789 ACCTTTGTGGAGAGGTTTTCTGG + Intergenic
1108936593 13:55889961-55889983 TCCTTTGTGGAGAGATTTTCTGG - Intergenic
1109300394 13:60584873-60584895 ACCTTTGAGGAGAGGTTTTCTGG + Intergenic
1110432850 13:75445161-75445183 ACCTGTGTGATTATCTTCTCTGG - Intronic
1110744447 13:79036526-79036548 ACCTTTGTGGAGAGGTTTTCTGG - Intergenic
1111944291 13:94647594-94647616 AACTGTGTGCAGAACTCCTCTGG - Intergenic
1113313070 13:109151252-109151274 TACTCTGTGCAGAGCTTCTCAGG + Intronic
1113661435 13:112108558-112108580 ACCTGTGCCCAGAGCTTCTGTGG - Intergenic
1114162181 14:20180294-20180316 ACCTTTGTGGAGAAGTTTTCTGG - Intergenic
1116771709 14:49133710-49133732 ACCTTCGTGGAGAGGTTTTCTGG - Intergenic
1117043286 14:51787398-51787420 ACCTGGGTGGAGACCTTAGCTGG + Intergenic
1120847595 14:89139608-89139630 ACCTGTGTGGAGAGCTTCTCAGG + Intronic
1121699227 14:95939583-95939605 GCCTGTGTGGAGAGCATCCCTGG - Intergenic
1121993565 14:98584368-98584390 AGCTGTGAGCAGAGCTTCTGCGG - Intergenic
1125447975 15:39777902-39777924 TCCTGTGTCCACAGCTTCTCTGG - Intronic
1127007403 15:54585650-54585672 ACCTTTGTGGAGAAGTTTTCCGG - Intronic
1127616422 15:60690470-60690492 ACCTGTGAGCAGAGCTTCCTTGG + Intronic
1127793192 15:62416347-62416369 ACCTTTGTGGAGAGGTTTTCTGG - Intronic
1129899436 15:79135012-79135034 ACCTTTGTGGAGAGGTTTTCTGG + Intergenic
1131492108 15:92872325-92872347 ACCTGTAGTCAGAGCTTCTCAGG - Intergenic
1135190344 16:20349128-20349150 ACCTGTCAGGAGGGCTTCACCGG - Exonic
1135436070 16:22427587-22427609 TCCTGTGTGGACACTTTCTCAGG + Intronic
1137542747 16:49376395-49376417 GGCTGTGTGGGGAGCTACTCAGG + Intronic
1137622850 16:49887753-49887775 ACCTGTGGTGACAGCTACTCAGG + Intergenic
1139995428 16:70976357-70976379 ACCTTTGTGGATAGATTTTCTGG + Intronic
1140450396 16:75065949-75065971 ACCTGTTGGGAGGGCTCCTCTGG + Intronic
1141372830 16:83503406-83503428 ACCTGGGTGGAGCCCATCTCAGG + Intronic
1141802868 16:86323059-86323081 CCCTGAGGGGAGGGCTTCTCAGG - Intergenic
1142134818 16:88446920-88446942 TCCTGTGCCGAGAGCTTCCCCGG + Intergenic
1142891765 17:2948492-2948514 GCCTGTGTGTAGAGCTGCTGTGG + Intronic
1142891826 17:2948768-2948790 GCCTGTGTGTAGAGCTGCTGTGG + Intronic
1145071642 17:19814669-19814691 ACCTGTAGTCAGAGCTTCTCTGG - Intronic
1146040727 17:29451618-29451640 AGATCTGTGAAGAGCTTCTCTGG - Exonic
1146059634 17:29597728-29597750 GCTTGTGGGGAGAGCTGCTCTGG + Intronic
1147047932 17:37768549-37768571 GCCTCTGTGGAGAGCATCTTAGG - Intergenic
1147471714 17:40668464-40668486 ACCTTTGTGGAGAGGATTTCTGG - Intergenic
1149820661 17:59773797-59773819 ACCTGAGAGGCGAGCTGCTCTGG - Exonic
1152325450 17:79633346-79633368 ACCTGAGCCCAGAGCTTCTCCGG - Intergenic
1155450167 18:25954570-25954592 ACCTTTGTGGAGAGGGTTTCTGG - Intergenic
1157221326 18:45830122-45830144 ACCTCTGTGTAGATCTTCTGTGG - Intronic
1157975556 18:52323326-52323348 CCCTGTGTTGAGAGCTGCTGAGG - Intergenic
1159502548 18:69292810-69292832 ACCTTTGTGGAGAGGATTTCCGG - Intergenic
1159869642 18:73745856-73745878 ACCTTTGTGGAGAGGGTTTCTGG - Intergenic
1163046250 19:14644694-14644716 ACCTGTGTGAAGAGTGACTCAGG + Intronic
1163114521 19:15180974-15180996 ACCTGCCTCGAGAGCTTCACGGG - Exonic
1166344907 19:42159470-42159492 ACCTGTGGGTTAAGCTTCTCTGG + Intronic
1168593118 19:57652942-57652964 ACATGTCTGGACAGCTGCTCAGG + Intergenic
925561104 2:5196610-5196632 TCCTGAGTGGTGAGCTGCTCTGG + Intergenic
930246861 2:48992449-48992471 GGCTGTGTGGAGAGCATCTTTGG - Intronic
931619340 2:64194111-64194133 TCTTCTGTGGTGAGCTTCTCTGG + Intergenic
931931988 2:67148421-67148443 ACTGGTGTGGAGAGCATCTATGG + Intergenic
932406644 2:71517205-71517227 ACCTTTGTGGAGAGGTTTTCTGG - Intronic
933892714 2:86786286-86786308 ACCTCTGTGGAGACCTTGACAGG - Intronic
936397973 2:112143373-112143395 GCCTGTGTGGGGAGCTGCTATGG + Intronic
936981840 2:118272005-118272027 ACCTGTTTGGAGACCTTTCCTGG - Intergenic
946374801 2:219301632-219301654 AGGAGTGTGGAGAGCTGCTCAGG + Exonic
946942795 2:224787353-224787375 ACATGTGTGTGGAGTTTCTCTGG - Exonic
946960667 2:224982296-224982318 AAATGTGTGGACAGCTCCTCTGG + Intronic
948726481 2:239937112-239937134 AGCTGTGCGGTGAGCGTCTCTGG - Intronic
948733326 2:239980952-239980974 ACCTGTGTGGAGAGAAGCTCTGG - Intronic
948756943 2:240165521-240165543 GCCTGTATGGAGAGCTTTCCTGG + Intergenic
1169529545 20:6469706-6469728 ACATTTGTTGAGAGCTTGTCAGG + Intergenic
1170307643 20:14957715-14957737 ACCAGTGTGTAGCACTTCTCTGG + Intronic
1170746907 20:19107597-19107619 ACCAGTGTGGAGAACATCTATGG - Intergenic
1172175070 20:32967127-32967149 CCCTGGGTGGAGATTTTCTCAGG + Intergenic
1173917199 20:46716488-46716510 AGATGTATGGAGAGTTTCTCTGG - Intronic
1176081210 20:63273957-63273979 ACCTGTGGGGAGAGGTGCCCTGG - Intronic
1176167800 20:63683086-63683108 ACCTGTGTTCACAGCTCCTCGGG - Intronic
1176917440 21:14643833-14643855 CCTGGTGTGGAGAGCATCTCTGG + Intronic
1178110400 21:29364261-29364283 AGCTGTGAGGAGAGATTGTCCGG + Intronic
1178949275 21:36973103-36973125 GCCTGTGGTGACAGCTTCTCGGG + Intronic
1179497666 21:41784017-41784039 AGCTGAGTGTGGAGCTTCTCAGG - Intergenic
1179538301 21:42066928-42066950 ACCTTTGTGGAGAGGTTTCCTGG + Intronic
1180078435 21:45475121-45475143 ACCTGTGCGGGGAGCATCTGCGG + Intronic
1181403115 22:22663829-22663851 ACCTGTGTGCAGAGTGGCTCCGG + Intergenic
1184443795 22:44535495-44535517 ACCTGGAGGGAGAGCTCCTCAGG + Intergenic
1184682059 22:46077717-46077739 ACCTGTGTGGAGAGAGTGGCTGG + Intronic
950740766 3:15050200-15050222 GCCTGTGTGGCCAGCTTCACAGG - Exonic
960248722 3:115428273-115428295 AACTATGTGGTGAGGTTCTCTGG - Intergenic
961595351 3:128011609-128011631 ACCTTTGTGGAGAGGTTTTCTGG + Intergenic
963245529 3:143056396-143056418 ACCTGTGTGGAGATCTGGACTGG - Exonic
963722228 3:148875091-148875113 ACCTGTGTTCAGACCTTCTTGGG - Intronic
964559713 3:157980791-157980813 AGCTGTGTGGAGAGTCTTTCTGG - Intergenic
964808584 3:160638473-160638495 ACCTGTGAGCAGACCTTTTCAGG - Intergenic
966517016 3:180829720-180829742 ACCAGTTTGGAGAACTTCCCGGG + Intronic
969070131 4:4529644-4529666 ACGTGTGTGCTGTGCTTCTCCGG - Intronic
969669484 4:8581883-8581905 AGCTGTGGGGTGTGCTTCTCCGG + Intronic
973584277 4:52375411-52375433 GCCTCTGTTCAGAGCTTCTCCGG - Intergenic
979840211 4:125429952-125429974 AACTGTGTGGAGAGGTTCTCCGG - Intronic
984782572 4:183539185-183539207 ACCTGCCTGTAGATCTTCTCAGG + Intergenic
984993324 4:185403365-185403387 CCCTGTGTGGAGGCCTTCTGAGG - Intronic
993785341 5:92126169-92126191 ACCTGTGTGGAACTCTTCTTTGG - Intergenic
994040327 5:95251939-95251961 ACCTTTGTGGAGAAGTTTTCTGG - Intronic
994759976 5:103840090-103840112 CCCTGGGAGGAGAGCTGCTCTGG + Intergenic
995386405 5:111594581-111594603 ACCTTTGTGGAGAGGTTTTCTGG + Intergenic
995406328 5:111800689-111800711 ACCTTTATGGAGAGATTTTCTGG - Intronic
995566340 5:113435545-113435567 ACCTGTGTGGACAGCATCAAGGG - Intronic
996523179 5:124449688-124449710 ACCTGTCTGGGAAGCTTTTCTGG - Intergenic
997800286 5:136853938-136853960 AACTGTGTGGAGAGACTCTCAGG - Intergenic
997990778 5:138543046-138543068 ACCTTTGTGGCGAGCTGCACCGG - Intronic
999203314 5:149831675-149831697 ACCTCTCTGGGGAGCTTCTTAGG - Intronic
999435340 5:151559296-151559318 GCCTGAGTGTGGAGCTTCTCAGG - Intronic
1001541520 5:172543002-172543024 GCATGTGGGGAGAGGTTCTCTGG - Intergenic
1003105048 6:3209085-3209107 ACCTGTCTGGAGAGTTTCATAGG - Intergenic
1004821378 6:19371766-19371788 AGCTGTGTGGTGTGATTCTCAGG - Intergenic
1007272412 6:40648577-40648599 ACCTACCTGGAGAGATTCTCAGG + Intergenic
1007728801 6:43933243-43933265 TCCTGTGGGGAGACCTTCTCTGG + Intergenic
1012738462 6:102981490-102981512 ACTTGTGTGGCGAGATTTTCTGG - Intergenic
1013282183 6:108648870-108648892 ACCTGTGTTTCCAGCTTCTCAGG + Intronic
1013835834 6:114334155-114334177 ACCTGACTTGAGTGCTTCTCAGG - Intronic
1014094081 6:117440544-117440566 ACATGTATGGAGAGTTTATCAGG + Intronic
1016135095 6:140531716-140531738 AGCTATGTAGAGAGCATCTCTGG + Intergenic
1016915089 6:149237439-149237461 ACCTGTGTGCAATGCCTCTCAGG - Intronic
1017329456 6:153178535-153178557 ACCTGTGTCTGGAGCCTCTCTGG + Intergenic
1018055133 6:160045761-160045783 ACCAGTGTTGAGAACTTCTGGGG + Exonic
1018477372 6:164157103-164157125 ACCTGAGAGGTGAGCCTCTCAGG - Intergenic
1019837552 7:3404608-3404630 ACTGGTTTGGAAAGCTTCTCTGG + Intronic
1021218753 7:17949778-17949800 AACTCTCTGGAGAGGTTCTCAGG - Intergenic
1022746338 7:33176130-33176152 ACCTGTTTTTAGAGCTTTTCCGG + Intronic
1023264037 7:38386937-38386959 CCCTGAGTGTACAGCTTCTCTGG - Intronic
1025732697 7:64120495-64120517 ACGTGGTTGGAGAGCTTATCGGG + Intronic
1028007839 7:85599882-85599904 GCCTGTGTGTATAGCTGCTCAGG - Intergenic
1029044003 7:97608114-97608136 ACCTTTGAGGAGAGGTTTTCTGG - Intergenic
1029800616 7:102943508-102943530 ACCTTTGTGGAGAGAATTTCTGG - Intronic
1030794012 7:113764947-113764969 ACCTTTGTGGAGAGGTTTTTGGG - Intergenic
1033255641 7:139799191-139799213 ACCTGTGGTGTCAGCTTCTCGGG - Intronic
1033529771 7:142250206-142250228 ACCTTTGTAGAGAGGTTTTCTGG - Intergenic
1034385353 7:150736597-150736619 GCCTCTGTGGAGAGGTTTTCTGG + Intronic
1039558664 8:38495677-38495699 ACCTGTGTGAAGTGCTTGGCAGG - Intergenic
1041231371 8:55756623-55756645 ACCTGTGTGGAGAGGTAGCCTGG + Intronic
1043546590 8:81322337-81322359 ACCTTTGAGGAGAGGTTTTCTGG - Intergenic
1047392134 8:124460952-124460974 TGCTGTGAGGAGAGGTTCTCGGG + Intronic
1049455264 8:142683358-142683380 ACCTGGGTGGGGACCTGCTCAGG + Intergenic
1050476690 9:6047972-6047994 ACCTGTGGTGACAGCTCCTCAGG - Intergenic
1050511818 9:6404220-6404242 CACTGTGTGCAGAGTTTCTCTGG - Intergenic
1053043010 9:34890678-34890700 CCCTGTGTGGAGATATTCTTTGG + Intergenic
1053057070 9:34999600-34999622 AGCTGTGTTCAGTGCTTCTCAGG - Intergenic
1055205099 9:73720164-73720186 ACCAATGTGGAGAGATTTTCAGG + Intergenic
1057426565 9:94955244-94955266 ACCTGCATGAAGATCTTCTCCGG - Exonic
1060490315 9:124079350-124079372 CACTTTGTAGAGAGCTTCTCCGG - Intergenic
1062382374 9:136292605-136292627 GCCTGTGCTGAGAGCTTCACCGG - Intronic
1187448897 X:19380026-19380048 ACCTTTGTGGAGAGGTTTTCTGG + Intronic
1188329195 X:28847666-28847688 AGCTGTGTGGAAAGCATCCCAGG - Intronic
1191957349 X:66658578-66658600 AATGGTGTGGAGAGCATCTCTGG + Intergenic
1192363552 X:70453753-70453775 ACCTGAGTGGGGAGCTGCGCAGG + Exonic
1194496928 X:94627707-94627729 ACCTTTTTGGAGAGGTTTTCTGG + Intergenic
1196590701 X:117483173-117483195 TGCTGTGTGGGGAACTTCTCTGG + Intergenic
1199733956 X:150666882-150666904 ATCTGTCAGGAGAGCTTCTTGGG + Intronic
1199815141 X:151391100-151391122 ACCTTTATGGAGAGGTTATCTGG + Intergenic
1200130973 X:153845635-153845657 ACTTTTGTGGAGAGGTTTTCTGG + Intergenic
1201278846 Y:12323262-12323284 ACTTCTGTGGGGACCTTCTCTGG - Intergenic