ID: 1120847595

View in Genome Browser
Species Human (GRCh38)
Location 14:89139608-89139630
Sequence ACCTGTGTGGAGAGCTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120847590_1120847595 1 Left 1120847590 14:89139584-89139606 CCTGCAGGTGAGAGAGAGCCTGG 0: 1
1: 0
2: 6
3: 50
4: 427
Right 1120847595 14:89139608-89139630 ACCTGTGTGGAGAGCTTCTCAGG 0: 1
1: 0
2: 1
3: 17
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120847595 Original CRISPR ACCTGTGTGGAGAGCTTCTC AGG Intronic