ID: 1120850203

View in Genome Browser
Species Human (GRCh38)
Location 14:89162887-89162909
Sequence GGTCAGCGGAGACCCCAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120850203_1120850213 26 Left 1120850203 14:89162887-89162909 CCTCCTTGGGGTCTCCGCTGACC 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1120850213 14:89162936-89162958 CTCAGTCCGCATCCGGCAGCTGG 0: 2
1: 0
2: 0
3: 6
4: 78
1120850203_1120850209 -3 Left 1120850203 14:89162887-89162909 CCTCCTTGGGGTCTCCGCTGACC 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1120850209 14:89162907-89162929 ACCACTGGGGAGCCACAAGATGG 0: 1
1: 0
2: 3
3: 18
4: 193
1120850203_1120850212 19 Left 1120850203 14:89162887-89162909 CCTCCTTGGGGTCTCCGCTGACC 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1120850212 14:89162929-89162951 GCTCACTCTCAGTCCGCATCCGG 0: 1
1: 1
2: 1
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120850203 Original CRISPR GGTCAGCGGAGACCCCAAGG AGG (reversed) Exonic
900120610 1:1047179-1047201 GGTTAGTGGGGACCCCAGGGTGG - Intronic
900186568 1:1335839-1335861 GGTCAGCCGAGAGCCCGAGGGGG + Exonic
900221466 1:1511639-1511661 GGGCTGCGGAGACACCGAGGAGG + Intergenic
900439274 1:2645271-2645293 GGTATGCGGCGGCCCCAAGGTGG - Exonic
900746229 1:4362466-4362488 GCTCAGCGGAGATCACAATGTGG + Intergenic
901314265 1:8295195-8295217 AGCCAGGGCAGACCCCAAGGAGG + Intergenic
902966708 1:20010230-20010252 GGTCAGGTGAGACACAAAGGAGG + Intergenic
903537133 1:24074424-24074446 GGCCAGAGGGGACCCTAAGGAGG - Intronic
903926331 1:26833430-26833452 GGTCAGGGGAGACCTCTAGGAGG + Intronic
905788150 1:40774347-40774369 GGTCTGCGGAGGCCACAAGGGGG + Intergenic
908088508 1:60662060-60662082 AGGCAGAGGAGACCCCAAAGAGG - Intergenic
908524686 1:64976424-64976446 GGTCAGAGGAGCAGCCAAGGTGG - Intergenic
909634188 1:77796947-77796969 GGTCAGAGGTGACCACAAAGGGG - Intronic
915072095 1:153278391-153278413 TGCCAGCGGGGAGCCCAAGGTGG - Intergenic
917310669 1:173674499-173674521 GGTTAGAGCAGTCCCCAAGGTGG + Intergenic
917519264 1:175734520-175734542 GGTCAGCGGAGACACTTAGAGGG + Intronic
921889765 1:220342082-220342104 GGTGAGCAGAGACCACATGGTGG - Intergenic
923499028 1:234549549-234549571 GCTCAGCGGGGAGACCAAGGAGG + Intergenic
1063200569 10:3782715-3782737 TGTCAGCCGTGTCCCCAAGGGGG - Intronic
1066101501 10:32122287-32122309 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1067723408 10:48747953-48747975 GGGCAGCTAAGACCCCATGGAGG - Intronic
1069755800 10:70773979-70774001 GGGCTGGGGACACCCCAAGGGGG - Intronic
1070821262 10:79356091-79356113 GGTAAACTGAGACCCCAAGAGGG + Intergenic
1077191768 11:1258693-1258715 GGTGGGCAGAGACCCCATGGGGG - Intronic
1077713106 11:4555185-4555207 GGTCAGAGGAGACACTAAGCGGG + Intergenic
1081731535 11:45375325-45375347 GGTTAGCGGAGCTCCCAAGCTGG + Intergenic
1085532855 11:77202131-77202153 GGACCTCAGAGACCCCAAGGAGG + Intronic
1088513347 11:110600021-110600043 GCTCAGAGGAGACCCACAGGGGG - Intronic
1090265053 11:125348446-125348468 GGCCTGTGGTGACCCCAAGGAGG + Intronic
1091985958 12:4910417-4910439 AGTCAGCGGAGAGCCCGAGTGGG - Exonic
1094639678 12:32261819-32261841 GGGCAGCAGAGACCCAAAAGTGG + Intronic
1096041984 12:48525670-48525692 GGTCGGCAGACAGCCCAAGGAGG - Exonic
1096171951 12:49478920-49478942 GCTCAGCGGAGACCCGCAGTGGG + Intronic
1096650677 12:53060631-53060653 GGTCAGCAGAGCCCCCATTGTGG - Intronic
1097267851 12:57755938-57755960 TGTCAGCGGAGACCGCGAGCAGG + Intronic
1098208975 12:68142574-68142596 GGTGAGCGGGGTCCCCATGGTGG - Intergenic
1101824473 12:108209802-108209824 GGGCAGGGGAGACCCTGAGGTGG - Intronic
1103950670 12:124549414-124549436 GCTCAGCAGAGATCCCTAGGGGG - Intronic
1113808955 13:113126079-113126101 GGTCAGCGCAGAGCCCAGTGTGG + Intronic
1113941127 13:114019090-114019112 GGTCACCGGGGATCCCCAGGAGG + Intronic
1117063190 14:51983413-51983435 GGTCAGAGGAGGCCTCATGGAGG - Intergenic
1119484369 14:74978348-74978370 GGGCAGCGGGAACCTCAAGGTGG + Intergenic
1120850203 14:89162887-89162909 GGTCAGCGGAGACCCCAAGGAGG - Exonic
1121441272 14:93951086-93951108 GGTGAGCGGAGGAGCCAAGGTGG - Exonic
1121737065 14:96225941-96225963 GGACACCGGAGACCACCAGGGGG + Intronic
1122847260 14:104506674-104506696 GGCCAGCTGACACCCCACGGTGG - Intronic
1124003057 15:25775462-25775484 GGTCAGCAGTGATGCCAAGGCGG - Intronic
1124705873 15:31963677-31963699 TGTCAGTGGAGGCCCCATGGAGG - Intergenic
1125508848 15:40282250-40282272 GTTCAGCGGTGACCCCGAGGCGG - Exonic
1131018534 15:89078065-89078087 GGTCAGAGATGATCCCAAGGTGG - Intergenic
1133242869 16:4426018-4426040 GGTCAGGGAAGACGCAAAGGCGG - Exonic
1133455982 16:5942992-5943014 GGTCAGTGCAGACCCCTTGGGGG - Intergenic
1138343059 16:56303341-56303363 GGTCAGAGGAGAGCCCCATGTGG + Intronic
1139947132 16:70649094-70649116 GGACAGGCGAGCCCCCAAGGGGG + Intronic
1140123956 16:72105215-72105237 GGTCACCTGAGAGCCCAGGGAGG - Exonic
1140396027 16:74627546-74627568 GGTCAGGTGAGACACAAAGGAGG - Intronic
1140420918 16:74818032-74818054 GCTCTGCCGAGAACCCAAGGTGG + Intergenic
1141097075 16:81170534-81170556 GGTCAGAGAAGACCCCCAGAAGG + Intergenic
1141606116 16:85154295-85154317 TCTCAGAGGAGACCCCAAGTGGG + Intergenic
1142149409 16:88506076-88506098 GGCCAGTGGAGAGCCCAGGGTGG - Intronic
1142198181 16:88748445-88748467 GCCCAGCTCAGACCCCAAGGTGG + Intronic
1142208101 16:88793530-88793552 GGACAGCGCAGACCCCACAGCGG + Intergenic
1144809583 17:17990164-17990186 GGTCAGTGTAGACCCTGAGGGGG - Intronic
1146265868 17:31452342-31452364 GGTCCTCGGAGACTCCTAGGTGG - Intronic
1150281336 17:63931175-63931197 GCTCAGAGGAGATCCTAAGGAGG + Intronic
1152203776 17:78962662-78962684 GGTCAGCGTCGATCCAAAGGTGG - Intergenic
1152303661 17:79509213-79509235 GGACAGCGGGGTCCCCAAGGCGG + Intronic
1152990000 18:354764-354786 GGTCAGTGGAGGCCTGAAGGAGG + Intronic
1155154728 18:23148720-23148742 GGTCAGCTGTGACCTCACGGTGG + Intronic
1160967811 19:1754240-1754262 CGACAGCGGCGACCCCATGGCGG - Exonic
1161278746 19:3433847-3433869 GGACAGTGGAGGCCCCAGGGAGG - Intronic
1162386192 19:10361874-10361896 GGGCAGCGGGGACCCTGAGGAGG - Exonic
1163004355 19:14388405-14388427 GGTCAGAGGGGATCCCAGGGTGG - Intronic
1163063108 19:14774329-14774351 GGTCAGAGGGGATCCCAGGGTGG + Intronic
1164925162 19:32124575-32124597 GGTCAGGGGAGGCCACAGGGCGG + Intergenic
1165408810 19:35645842-35645864 GGTCAGGGGAGACTCCCTGGAGG + Intergenic
1166883107 19:45940777-45940799 GGTCAGCGGCGAGCCCGAGCAGG - Exonic
1167566241 19:50259095-50259117 GGTCAGCGGCGGCCACACGGGGG - Intronic
1167667787 19:50832790-50832812 GGTCAGAGAAGGCCTCAAGGAGG - Intronic
1167745642 19:51350166-51350188 CCTCAGCAGAGACCTCAAGGAGG + Intronic
1168194133 19:54760956-54760978 GGTCAGGAGAGACCCAGAGGAGG + Intronic
1168196182 19:54775689-54775711 GGTCAGGAGAGACCCAGAGGAGG + Intronic
924963932 2:58315-58337 GCTCAGAGGAGACCCACAGGTGG - Intergenic
929573613 2:43038952-43038974 GGCCACCAGAGCCCCCAAGGGGG - Intergenic
929956858 2:46464642-46464664 GTTAAGCGGGGACCACAAGGGGG + Intronic
932439046 2:71720233-71720255 TGTCAGAGGGTACCCCAAGGAGG - Intergenic
933721551 2:85400593-85400615 GGTGAGCTGAGCCACCAAGGTGG - Intronic
934573358 2:95385419-95385441 GGTCAGCAGAAACCCCCAGGAGG + Exonic
934993396 2:98936536-98936558 GGGCACCGGAGACCCGGAGGTGG + Intergenic
937047126 2:118857737-118857759 GGCCCGCGGAGAGCCCAGGGCGG + Intergenic
937886277 2:126901773-126901795 GGCCAGGGGAGACTCCCAGGAGG + Intronic
938382334 2:130843635-130843657 GGTCAGGGGAGAGCCCAACGGGG - Intronic
944748217 2:202679602-202679624 GTTCAGTGGAGACCCCAAAAGGG + Intronic
945929788 2:215843175-215843197 GTTGAGCAGAGACCCAAAGGAGG - Intergenic
946153171 2:217789763-217789785 GGAGAGAGGAGACCCCAAGGGGG + Intergenic
946529540 2:220557126-220557148 GGTCAGCTCTGGCCCCAAGGAGG - Intergenic
947822529 2:233082003-233082025 GCTAAGCGGAGACCTTAAGGAGG - Intronic
948355186 2:237372170-237372192 GTTCAGCGATGACCCCAAGGTGG - Exonic
948904793 2:240973680-240973702 GGCCAGCGGGGCCCACAAGGTGG + Intronic
1168968328 20:1913563-1913585 GGTCAGTGGAGAGCCCAACTGGG + Intronic
1169225750 20:3855634-3855656 GGACAGCGGAGACAACAATGGGG - Intronic
1170183234 20:13556796-13556818 GGTCAACGGAGACCCCTATGAGG - Intronic
1171324752 20:24281608-24281630 GGTCTGAGGAGACTCCAAGGAGG + Intergenic
1173892004 20:46520012-46520034 GGACAGCTGAGCCCCCAAAGTGG - Intergenic
1174042251 20:47708344-47708366 GGGCATCGCAGAACCCAAGGGGG + Intronic
1174197682 20:48785279-48785301 TGTCAGAGGAGACCCCAGGCAGG - Intronic
1176236587 20:64056427-64056449 GCTCGGCAGAGCCCCCAAGGTGG + Intronic
1176243848 20:64088063-64088085 GGTCAGCAGAGCCCCGCAGGAGG - Intronic
1179730362 21:43364141-43364163 GGTCAGCGGGGACCACGTGGAGG + Intergenic
1180049601 21:45325214-45325236 GTGCAGGGAAGACCCCAAGGAGG + Intergenic
1180126459 21:45793646-45793668 GGACAGCGGAGACTCCACAGGGG + Intronic
1180797157 22:18611528-18611550 GGCACGCGGAGACCCCCAGGGGG - Exonic
1180953830 22:19732544-19732566 GGGCAGAGAAGACCCCCAGGAGG - Intergenic
1181038619 22:20181657-20181679 GGGCATCAGAGAGCCCAAGGTGG - Intergenic
1181068837 22:20320195-20320217 CCTCTGCGGAGACTCCAAGGAGG + Intergenic
1181224566 22:21383743-21383765 GGCACGCGGAGACCCCCAGGGGG + Exonic
1181254066 22:21551070-21551092 GGCACGCGGAGACCCCCAGGGGG - Exonic
1183495205 22:38139318-38139340 GGAAAGAGGAGACCCCAAAGAGG + Intronic
1183520089 22:38291747-38291769 GGGCAGCGGGCACCACAAGGGGG + Exonic
1185088779 22:48754770-48754792 GGGCAGTGCAGAACCCAAGGGGG - Intronic
954671519 3:52293692-52293714 CGTGAGCAGAGACCCCAGGGAGG + Intergenic
956658940 3:71581493-71581515 GGACACCGGAGAGCCCCAGGCGG - Intronic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
962071029 3:132034240-132034262 GGTCAGGGAAGTCCCGAAGGCGG - Intronic
967941334 3:194768807-194768829 GGTCCACGGTGACCCCAAGGAGG + Intergenic
968626211 4:1627783-1627805 GCTGAGTGGAGACCCCCAGGTGG - Intronic
968934743 4:3604150-3604172 GGGGAGCGGGGACCCCAGGGTGG + Intergenic
979462910 4:121003775-121003797 GCTCAGAGGAGACCCACAGGGGG - Intergenic
980464605 4:133156187-133156209 GGGCAGCGTACACCCCATGGTGG + Intronic
981005002 4:139865772-139865794 GGTCAGAGGAGGACCCAAGCAGG - Intronic
981540671 4:145843526-145843548 GGTAAGAGGAGGCCCCAAGTTGG - Intronic
985696870 5:1345639-1345661 GGTCAGCAGAGGCCCCTCGGAGG + Intergenic
986495017 5:8332857-8332879 GGTCAGCGGTGAACACAAGGTGG + Intergenic
987327439 5:16825196-16825218 TTTGAGCTGAGACCCCAAGGAGG - Intronic
990598434 5:57333648-57333670 GGTCAGGGGAGGCCTCTAGGAGG + Intergenic
991676585 5:69094399-69094421 TGTCAGCGGAGACCGGAGGGAGG - Intronic
997960493 5:138316850-138316872 GCTCAGAGGAGACCCACAGGGGG - Intronic
999206640 5:149853070-149853092 GGTCAAAGGAGTCTCCAAGGCGG + Exonic
1000802282 5:165743260-165743282 GGTCAGCTGAGCCCAGAAGGAGG - Intergenic
1003478340 6:6505936-6505958 TGTCAGCGGAGACACACAGGTGG - Intergenic
1003735131 6:8869513-8869535 GATCAGAGAAGACCCCACGGGGG + Intergenic
1006348022 6:33498639-33498661 GGTCAGAGGAGACCCACAGTGGG - Intergenic
1007239725 6:40416388-40416410 GGTCAGCCAACATCCCAAGGGGG + Intronic
1007268041 6:40612003-40612025 GGTCAGAGGAGAAGCCAGGGAGG + Intergenic
1007915891 6:45561382-45561404 GGGCAGAGGGGGCCCCAAGGAGG + Intronic
1013709381 6:112879798-112879820 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1015417056 6:132961436-132961458 GGGCAGCAGAGGCCCCATGGTGG + Intergenic
1017115887 6:150975948-150975970 GGGAAGCGGGGACGCCAAGGCGG + Intronic
1018690072 6:166337503-166337525 CGGCAGAGGAGACCCCAAGCAGG - Intronic
1019200132 6:170307134-170307156 GGTCAGAGGTGACCTCAAGATGG - Intronic
1022720497 7:32938112-32938134 GGTCTGAGGACTCCCCAAGGAGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1032761506 7:134947523-134947545 GGCCAGCGTGGACACCAAGGAGG + Exonic
1037948698 8:23005094-23005116 GGGTAGCAGAGACCCTAAGGGGG - Intronic
1038963740 8:32548980-32549002 GGTGAGCGGCGGCCCCCAGGAGG - Intronic
1041205457 8:55494558-55494580 GCTCAGAGGAGACCCAAAGTGGG + Intronic
1042100462 8:65270843-65270865 GGTCAGTAGAGACCTCAAGGGGG + Intergenic
1043963921 8:86450159-86450181 GGTAAGCAGAGACACTAAGGGGG - Intronic
1044409614 8:91868640-91868662 GCTCAGAGGAGACCCACAGGAGG - Intergenic
1048941494 8:139404274-139404296 GGTCAGCTGGGACCTCAGGGAGG + Intergenic
1048983156 8:139714162-139714184 GGTCAGAGGAGGCCCCAGAGAGG + Intergenic
1049426512 8:142540318-142540340 GTTCACAGGAGACCCCAAGGGGG - Intronic
1051642082 9:19232318-19232340 GGTCAACGGAGATACCAATGCGG - Intronic
1053267606 9:36726434-36726456 GGTCAGCACAGACTCCAGGGAGG + Intergenic
1055574349 9:77647316-77647338 GGTCACCACAGACCCCAAGCTGG + Intronic
1061566895 9:131446720-131446742 GCCAAGAGGAGACCCCAAGGGGG - Intronic
1062234534 9:135501500-135501522 GGCCACCTGAGACCACAAGGCGG + Intronic
1062308662 9:135923715-135923737 AGTCAGCGGGGAGCCCCAGGTGG + Intergenic
1062401314 9:136373882-136373904 AGACAGCAGAGACCCCCAGGGGG + Intergenic
1062497871 9:136840097-136840119 GGCCAACGGGGACCCCAAGCTGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1186635959 X:11405232-11405254 GGTCACCTGGGACCTCAAGGTGG - Intronic
1191016396 X:55813995-55814017 GCTCAGAGGAGACCCAAAGTGGG - Intergenic
1193108375 X:77703801-77703823 GCTCAGAGGAAACCCAAAGGGGG + Intronic
1195178485 X:102333793-102333815 GCTCAGAGGATACCCGAAGGGGG + Intergenic
1195180379 X:102353290-102353312 GCTCAGAGGATACCCGAAGGGGG - Intergenic
1195200653 X:102547221-102547243 GGTTAGCGGAGACCCTAAGGAGG - Intergenic
1195696882 X:107674030-107674052 GGTCCCTGGAGACTCCAAGGTGG - Intergenic
1198111945 X:133509663-133509685 GGGCAGAGGAGACCCTAAGAGGG + Intergenic
1199861072 X:151800989-151801011 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1199991165 X:152988446-152988468 GGTCAGAGAAGAGCCCCAGGAGG - Intergenic
1200000352 X:153056775-153056797 GGCCCGCAGAGACCCCACGGGGG + Intronic
1200003950 X:153075407-153075429 GGTCAGGGAAGAGCCCCAGGAGG + Intergenic
1200955258 Y:8938214-8938236 GGTCAGAGCAGAGGCCAAGGTGG - Intergenic