ID: 1120852237

View in Genome Browser
Species Human (GRCh38)
Location 14:89181711-89181733
Sequence TTACCTAAGAGGAGAACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120852229_1120852237 24 Left 1120852229 14:89181664-89181686 CCATACAAACTCCAAGATCTCCA 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1120852237 14:89181711-89181733 TTACCTAAGAGGAGAACCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 146
1120852231_1120852237 4 Left 1120852231 14:89181684-89181706 CCACACCAGCCTGATTTTGTCTG 0: 1
1: 0
2: 3
3: 56
4: 924
Right 1120852237 14:89181711-89181733 TTACCTAAGAGGAGAACCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 146
1120852235_1120852237 -5 Left 1120852235 14:89181693-89181715 CCTGATTTTGTCTGAGGGTTACC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1120852237 14:89181711-89181733 TTACCTAAGAGGAGAACCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 146
1120852230_1120852237 13 Left 1120852230 14:89181675-89181697 CCAAGATCTCCACACCAGCCTGA 0: 1
1: 0
2: 1
3: 93
4: 1462
Right 1120852237 14:89181711-89181733 TTACCTAAGAGGAGAACCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 146
1120852234_1120852237 -1 Left 1120852234 14:89181689-89181711 CCAGCCTGATTTTGTCTGAGGGT 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1120852237 14:89181711-89181733 TTACCTAAGAGGAGAACCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120852237 Original CRISPR TTACCTAAGAGGAGAACCGC AGG Intronic
900909684 1:5586308-5586330 TTGCCCAAGATGAGAAACGCTGG + Intergenic
903493893 1:23751429-23751451 TCTCCAAAGAGGAGAACCGAAGG + Exonic
904713815 1:32451554-32451576 ATACCTAAGAGTAGAATTGCTGG + Intergenic
904732679 1:32606774-32606796 TCACCCAAGAGGAGACCTGCAGG + Intronic
906843777 1:49168264-49168286 TTACCTAAAAGTAGAATTGCTGG + Intronic
907402129 1:54231025-54231047 ATACCTAGGAGGAGAACTGCTGG + Intronic
909551540 1:76903513-76903535 ATACCTAGGAGTAGAACTGCTGG - Intronic
909631058 1:77770367-77770389 TTACCTAGGAGTAGAATTGCTGG + Intergenic
911549073 1:99257917-99257939 GTACCTGTGAGGAGAACCGTTGG + Intergenic
911695298 1:100883758-100883780 TTACCTAAGAGTAGAATTGCTGG + Intronic
914878350 1:151529155-151529177 TTACCTAAGAGTGGAATTGCTGG + Intronic
915618043 1:157056833-157056855 ATACCTAGGAGGAGAATTGCTGG + Intergenic
915904513 1:159868012-159868034 TTACCTGGCAGGAGAACAGCAGG + Intronic
922043392 1:221919199-221919221 GTACCCAAGAGGAGAAGCACAGG - Intergenic
1065821989 10:29534179-29534201 TTAACTAAGAGCATAACAGCAGG - Intronic
1067830726 10:49609969-49609991 TTCCCCAAGAGGAGAAGAGCGGG + Intronic
1069970567 10:72164643-72164665 ATACCCAGGAGGAGAACTGCTGG + Intronic
1072171122 10:92862880-92862902 TTACCTAAGAGTGGAACTGTTGG + Intronic
1073937914 10:108656863-108656885 TTACCTAGGAGCAGAATTGCTGG - Intergenic
1075104721 10:119531219-119531241 TTACTTAAGAGAAGATCTGCTGG - Intronic
1081551432 11:44116518-44116540 TGACCTAGGAGCAGAACTGCTGG + Intronic
1083279388 11:61617200-61617222 ATACCTAAGAGTGGAACTGCTGG + Intergenic
1087390930 11:97533414-97533436 TTACCTAGGAGTAGAATCACTGG + Intergenic
1089123314 11:116157860-116157882 GTACCTAAGAGGAGAATGACTGG - Intergenic
1090490695 11:127158156-127158178 TTCCCTGAGAAGAGAACAGCAGG + Intergenic
1090679700 11:129041672-129041694 TGACCTAGTAGCAGAACCGCAGG + Intronic
1091257305 11:134200705-134200727 ATACCTAGGAGGAGAACTGCTGG - Intronic
1092111132 12:5965588-5965610 TTACCTAAAGGGAGAGCAGCAGG - Intronic
1092168514 12:6358408-6358430 TTACCTATGAGTGGAACTGCTGG - Intronic
1094644050 12:32303772-32303794 TTACATAAGAGAAAAACCTCTGG + Intronic
1096499251 12:52055284-52055306 TTAGCTAGGAGGAGAACCCAGGG - Intronic
1097682673 12:62663575-62663597 AGACCTAAGAGTAGAACTGCTGG + Intronic
1098905834 12:76161548-76161570 ATACCTAGGAGTAGAACTGCAGG + Intergenic
1099221508 12:79920370-79920392 ACACCTAAGAGTAGAACTGCTGG + Intronic
1101977910 12:109378203-109378225 ATACCTAAGAGTGGAACTGCTGG + Intronic
1104298830 12:127544004-127544026 ATACCTATGAGTAGAACCGCTGG + Intergenic
1104681345 12:130754129-130754151 ATACTTAGGAGGAGAACTGCTGG + Intergenic
1106164274 13:27228632-27228654 ATACCTATGAGTAGAACAGCTGG + Intergenic
1107099152 13:36570284-36570306 ATACCTAAGAGAAGAATTGCTGG - Intergenic
1108288252 13:48930230-48930252 ATACCTAGGAGTAGAACTGCTGG + Intergenic
1108366819 13:49724271-49724293 TCACCTAGGAGTAGAACTGCTGG + Intronic
1112605597 13:100902652-100902674 GTACCTAAAAGTAGAACTGCTGG + Intergenic
1117522329 14:56563118-56563140 TTACTTATGACGAGAACCCCTGG + Intronic
1118876494 14:69789188-69789210 ATACCTAAGAGTAGAATTGCTGG - Intronic
1119637688 14:76290102-76290124 TTGACTAAGATGAGAACAGCAGG + Intergenic
1120126234 14:80747212-80747234 TTACCTGGGAGTAGAACTGCTGG - Intronic
1120852237 14:89181711-89181733 TTACCTAAGAGGAGAACCGCAGG + Intronic
1124193687 15:27601580-27601602 TTACCTAAGAGGAGGAAGACAGG + Intergenic
1126605853 15:50475501-50475523 TTACCTAGGAGTAGAATTGCTGG - Intronic
1126855598 15:52836045-52836067 TTACCCAAGAGCAGAACCTTAGG + Intergenic
1127818001 15:62629425-62629447 TTTCCTAAGAGAAGAACCCTAGG + Intronic
1128416891 15:67454915-67454937 ATACCTAAGAGCAGAACTGATGG + Intronic
1128732171 15:70028765-70028787 TTAGCAAAGAGAAGAGCCGCGGG + Intergenic
1129246448 15:74281831-74281853 TTACCTCAGAGGAAAGCAGCTGG - Exonic
1130777183 15:86996620-86996642 ATACCTAAGAGTAGAATTGCTGG + Intronic
1131444896 15:92490339-92490361 ATACCTAGGAGGAGAACTGATGG - Intronic
1132133060 15:99303013-99303035 ATACCTAAGAGTAGAATTGCTGG + Intronic
1136107488 16:28040624-28040646 CAACCTAAGAAGAGACCCGCAGG + Intronic
1136469535 16:30470344-30470366 ATACCTAGGAGGAGAACTTCTGG + Intergenic
1137639859 16:50019304-50019326 ATACCTAAGAGAAGAATTGCTGG + Intergenic
1141966422 16:87447717-87447739 TTCCCTAGGACGAGAACTGCAGG + Intronic
1145829509 17:27904123-27904145 TTCCAAAAGAGGAGAACAGCAGG - Intergenic
1149163721 17:53725427-53725449 TTACCTGGGAAGAGAACTGCTGG + Intergenic
1156316229 18:35971647-35971669 ATACCTAAGAGTAGATCTGCTGG - Intergenic
1158760968 18:60385987-60386009 TAACCTGAGACAAGAACCGCAGG + Intergenic
1158996733 18:62928633-62928655 ATACCTAAGAGTAGAACTGCTGG - Intronic
1162765193 19:12914959-12914981 ATACCTAGGAGGGGAACTGCTGG - Intronic
927758741 2:25731078-25731100 ATACCTAAGAGTAGAATGGCTGG - Intergenic
927802611 2:26115218-26115240 ATACCTAAGAGTAGAACTGCTGG - Intronic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
932142744 2:69294110-69294132 TCACCCAAGAGGAGATCAGCTGG + Intergenic
932172492 2:69569980-69570002 ATACCTAAGAGTAGAAGTGCTGG + Intronic
932971897 2:76553778-76553800 ATACCTAAGAAGAGAAGTGCTGG - Intergenic
934904556 2:98187346-98187368 TCTCCTAAGAGGAGGAGCGCCGG + Intronic
939455438 2:142429141-142429163 TTACCTAGGAGTAGAATAGCTGG - Intergenic
941127451 2:161601909-161601931 ATACCTAAGAGTAGAATTGCTGG - Intronic
941172754 2:162159707-162159729 ATACCTAGGAGTAGAATCGCTGG + Intergenic
941880755 2:170477794-170477816 TTACCCAAGATGAGAACCACTGG + Intronic
942043251 2:172084734-172084756 TTTCCTGGGAGGAGAAGCGCGGG + Intronic
943698126 2:190958421-190958443 TTAACTAAGAGCAGAACTGAAGG - Intronic
943742833 2:191429125-191429147 ATACCTAAGAGTAGAACTGCTGG + Intergenic
944813345 2:203349907-203349929 ATACCTAAGAGTAGAATTGCTGG + Intronic
1168846527 20:948792-948814 GTACCTAAGAGTAGGACAGCTGG - Intergenic
1177158697 21:17524473-17524495 CTACCCAGGAGGAGAATCGCTGG + Intronic
1179451907 21:41473636-41473658 TTCCCCAAGAGGAGACCCCCAGG - Intronic
1180576125 22:16776341-16776363 TTACCTAATAAAAGATCCGCAGG - Intergenic
1181117070 22:20638607-20638629 TTACCTAATGGGAGAACCTCAGG + Intergenic
1181470083 22:23133078-23133100 ATACCTAAGAAGAGAATGGCTGG - Intronic
1182207221 22:28640847-28640869 ATACCTAAGAGTAGAATTGCTGG - Intronic
1184197667 22:42941403-42941425 ATACCTAGGAGTAGAACTGCTGG + Intronic
1184634414 22:45815422-45815444 TTACCTAAGATGAGCAGTGCAGG + Intronic
1184788133 22:46681724-46681746 GTACCTATGAAGAGAACCCCTGG - Intergenic
1184905808 22:47485742-47485764 TTACCTGAGACTAAAACCGCTGG - Intronic
952521692 3:34166179-34166201 ATACTTAAGAGGAGAATCACTGG + Intergenic
955300971 3:57778926-57778948 ATACCTAGGAGAAGAACTGCTGG - Intronic
956493583 3:69800447-69800469 TTACCTAAGAGCGGAATGGCTGG + Intronic
957378549 3:79392697-79392719 TTGCCCCAGAGGAGAACCACAGG - Intronic
960059105 3:113300979-113301001 ATACCTAAAAGTAGAACAGCTGG - Intronic
960509606 3:118532497-118532519 ATACCTAAGAGTAGAATGGCTGG + Intergenic
963134382 3:141887538-141887560 ACACCTAAGAGTAGAACTGCTGG - Intronic
963402870 3:144823496-144823518 TTACGTAAGAGGAGAGCAGAAGG - Intergenic
963862974 3:150329800-150329822 ATACCTAGGAGTAGAACTGCTGG - Intergenic
964495793 3:157288100-157288122 TTACATAAGAGGAAAGCCTCAGG - Intronic
965631906 3:170741531-170741553 TTACCTAAGAGGACATCCCAAGG + Intronic
966030561 3:175341517-175341539 GTACCTAAGAGTAGAATTGCTGG + Intronic
968997161 4:3953033-3953055 AGACCTGAGAGAAGAACCGCAGG - Intergenic
969446980 4:7250815-7250837 TTACTTAATAGGAGAAACCCAGG + Intronic
970850426 4:20596152-20596174 TTACCAAAGAGGAGGACAGAGGG + Intronic
972441121 4:39092984-39093006 TTACCTAGGAGTAGAACTGCTGG - Intronic
973935157 4:55838724-55838746 ATACCTAGGAGTAGAACTGCTGG - Intergenic
974259386 4:59505453-59505475 ATACCTAATAAGAGAATCGCTGG - Intergenic
975210518 4:71694568-71694590 TTTCCTAAGAGGATAATAGCTGG - Intergenic
976550149 4:86384629-86384651 TTACATTAGAGGAGGACAGCAGG + Intronic
977784102 4:101012918-101012940 TTACCTAAGAGAAGAAGCTGTGG + Intergenic
979991070 4:127376205-127376227 TTACCTAGGAGTAGAATTGCTGG - Intergenic
986310830 5:6550085-6550107 ATACCTAGGAGGGGAACTGCTGG + Intergenic
992703948 5:79369037-79369059 TTACCTAGGAGTAGAATTGCTGG - Intergenic
993546479 5:89219145-89219167 ATACCTAAGAGTAGAATTGCTGG + Intergenic
997464291 5:134076886-134076908 GTACCTAACAGGAGATCCGGAGG + Intergenic
997515509 5:134486368-134486390 TTATCTAAGAGCAGAATTGCTGG - Intergenic
999438558 5:151583182-151583204 TGACCTAGGAGTGGAACCGCTGG - Intergenic
999447797 5:151654653-151654675 TTACCTGAGAGGAGAAGGGGAGG - Intergenic
1001968622 5:175935398-175935420 TTTCCTAAGAGTGGAACGGCTGG - Intronic
1002248821 5:177908346-177908368 TTTCCTAAGAGTGGAACGGCTGG + Intergenic
1003528403 6:6917368-6917390 TTACCTGAGATGAGATCCGGGGG + Intergenic
1005906273 6:30263555-30263577 TTACCTAAGATGAGAACTTGTGG - Intergenic
1007354821 6:41306516-41306538 TTACCTGGGAGGAGATCTGCGGG + Intergenic
1009279540 6:61729452-61729474 ATACCGAAGAGAAGAACTGCTGG + Intronic
1009874410 6:69487253-69487275 TTACCTAAGAGTAGAATTGTTGG - Intergenic
1011755346 6:90493353-90493375 ATACCTAAGAGTAGAATTGCTGG - Intergenic
1014391710 6:120872641-120872663 TTACCTGAGTGGAGACCCACAGG - Intergenic
1020129399 7:5551014-5551036 TGTCCTCAGAGGAGGACCGCAGG + Intronic
1027950001 7:84803640-84803662 TTACCTGAGACCAGAACTGCTGG + Intergenic
1028620888 7:92827462-92827484 TTGCCTGAGAGGTGAACCGGAGG - Intronic
1030263599 7:107592563-107592585 ATACCTAAGAGATGAACTGCTGG - Intronic
1032108957 7:129058606-129058628 ATACCTAAGTGTAGAACTGCTGG - Intergenic
1032767586 7:135013389-135013411 TTACCTAAGAGATAAACTGCTGG - Intronic
1033867847 7:145714118-145714140 ATACCTAAAAGTAGAACTGCTGG + Intergenic
1034050153 7:147974795-147974817 TTACCTAAAAGTAGAAATGCTGG - Intronic
1036837470 8:12086549-12086571 ATACCTAAGAGTAGAATTGCTGG - Intergenic
1036859262 8:12332797-12332819 ATACCTAAGAGTAGAATTGCTGG - Intergenic
1037531708 8:19782379-19782401 ATACCTGAGAGAAGAATCGCTGG - Intergenic
1038416749 8:27402292-27402314 TTGCCTAAGATGAGAAACACTGG + Intronic
1038627989 8:29212694-29212716 GTACCTAAAAGTAGAACAGCTGG + Intronic
1038886966 8:31674275-31674297 TTACCTAGGAGTAGAACTTCTGG + Intronic
1039091918 8:33840097-33840119 ATACCTAAGAGCAGAATTGCTGG + Intergenic
1042238852 8:66641949-66641971 ACACCTAAGAGTAGAACTGCTGG + Intronic
1047970462 8:130079968-130079990 TTACCTACAAGGAAAACCGAAGG + Exonic
1055506484 9:76954753-76954775 TCACCAAAGAGGAGAACTGGGGG - Intergenic
1056149390 9:83769732-83769754 ATACCTAAGAGTAGAACTGCTGG + Intronic
1057341827 9:94209307-94209329 ATACCTAAGAGGAGAATGGCTGG + Intergenic
1057343398 9:94224715-94224737 ATACCTAAGAGTAGAATTGCTGG + Intergenic
1057574394 9:96230278-96230300 TTACCTAGGAGTAGAATCGCTGG - Intergenic
1185981555 X:4785452-4785474 ATACCTAAGAGTAGAATTGCTGG - Intergenic
1186391568 X:9164855-9164877 ATACCTATGAGTAGAACTGCTGG - Intergenic
1188511704 X:30943382-30943404 ATACCTAAGAGCAGAACTGCTGG + Intronic
1189378628 X:40485422-40485444 TTACCTAGGAGTAGAACTGCTGG - Intergenic
1190707916 X:53046155-53046177 ATACCTAAAAGTAGAACTGCTGG + Intergenic
1191721699 X:64235480-64235502 ATACCTAGGAGTAGAACTGCAGG + Intergenic
1194824765 X:98548341-98548363 CTACCTAAGAGTAGAATGGCTGG + Intergenic
1196890889 X:120289648-120289670 CTACCTAAGAGTATAACTGCTGG - Intronic
1198028022 X:132728154-132728176 ATACCTAAGAGTAGAATTGCCGG + Intronic