ID: 1120853207

View in Genome Browser
Species Human (GRCh38)
Location 14:89189300-89189322
Sequence GGAAGTCCCTGCCTTTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120853207_1120853211 -1 Left 1120853207 14:89189300-89189322 CCACTCCAAAGGCAGGGACTTCC 0: 1
1: 0
2: 0
3: 19
4: 235
Right 1120853211 14:89189322-89189344 CCACTGCTCAGCAAGCCATGTGG 0: 1
1: 0
2: 1
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120853207 Original CRISPR GGAAGTCCCTGCCTTTGGAG TGG (reversed) Intronic
900751635 1:4401474-4401496 GGCTGTCCCTGGCTCTGGAGAGG - Intergenic
903170583 1:21550252-21550274 AGAAATCCCTCCCTCTGGAGGGG + Intronic
903592205 1:24465579-24465601 GGGAGACCCTGCCCTTGCAGTGG + Intronic
903699671 1:25237465-25237487 GGAAGTCCAGGCCAATGGAGAGG - Intergenic
906662967 1:47595455-47595477 GGAAACCCCTGCTTGTGGAGGGG - Intergenic
907596506 1:55725302-55725324 AGAAGTCCCTGCCTTTTCTGGGG + Intergenic
907614844 1:55913193-55913215 AGGACACCCTGCCTTTGGAGAGG + Intergenic
908170239 1:61497315-61497337 GGTAGTCTTTGCCTTTGGAGGGG - Intergenic
908338264 1:63149427-63149449 GGAGCTCCCTGCCTTGGGTGGGG + Intergenic
908497206 1:64706563-64706585 AGCAGTCCCTGCCTTCGGGGAGG + Intergenic
912459320 1:109820472-109820494 GGTGGTCCCTGCCCTTTGAGGGG + Intergenic
914825553 1:151136178-151136200 GGAAGGGGCTGCCTTTGGACTGG + Intronic
916214455 1:162383613-162383635 GGAGGTCCGTGCCTGAGGAGGGG - Exonic
916764322 1:167845653-167845675 TGAAGTCCCTGCCTCGGCAGTGG + Exonic
917789844 1:178492493-178492515 GTATGTACCTGGCTTTGGAGAGG + Intergenic
918597332 1:186307719-186307741 GGGAGCCGCTGCCTTGGGAGTGG - Exonic
918602124 1:186375784-186375806 CCAAGTCCCTGGCTTTGGAGTGG + Intronic
920557187 1:206912785-206912807 TGTATTCCCTGCCTTTAGAGAGG - Intronic
921356584 1:214289977-214289999 TGAAGTACCTGCCTTTTCAGGGG + Intronic
923084612 1:230694138-230694160 GGAAGTTCCTTTCCTTGGAGGGG + Intergenic
923882910 1:238123275-238123297 GGAAGCCCTTGTCTTCGGAGAGG + Intergenic
924013892 1:239698421-239698443 GCATGTTCCTGCCTTTTGAGAGG - Intronic
924260613 1:242226782-242226804 GAATGTCCCTGGTTTTGGAGGGG + Intronic
1062809882 10:455247-455269 GTGAGTCCCTGCCTGAGGAGTGG + Intronic
1063079735 10:2754500-2754522 GGAAGTCCCGGCCTCAGGAGCGG + Intergenic
1063575384 10:7257354-7257376 TGAAGTCCCTGCCTTGCCAGTGG + Intronic
1065020204 10:21496524-21496546 GGAAAGCCCTGCCTCTGCAGCGG - Intronic
1065225846 10:23543094-23543116 GGAAGTGGTTGTCTTTGGAGAGG - Intergenic
1066104405 10:32144342-32144364 AGAAATCCCAGCCTTTTGAGAGG + Intergenic
1066953580 10:42145043-42145065 GGAACTGCATTCCTTTGGAGAGG + Intergenic
1067996630 10:51280908-51280930 GGAGCTGCCTTCCTTTGGAGGGG + Intronic
1068184715 10:53570024-53570046 GGAAGTCTCTGCTTTAGGACTGG - Intergenic
1068224634 10:54091311-54091333 GGCAGTTCCTGTCTGTGGAGAGG - Intronic
1070148760 10:73792690-73792712 GGCAGCCCCTGCAGTTGGAGAGG + Exonic
1070401362 10:76056197-76056219 GGAACAACCTGCCTGTGGAGAGG - Intronic
1073085316 10:100884507-100884529 GGAAGGCCCAGCCCTTGGGGTGG + Intergenic
1073219919 10:101862842-101862864 GAAAGTCCCTGCCTTTTAATTGG - Intronic
1076464651 10:130670706-130670728 GGTAGTGGCTGCCTCTGGAGGGG - Intergenic
1077284141 11:1758427-1758449 GCAACTCCCTGCCCTAGGAGAGG - Intronic
1079348143 11:19670689-19670711 GGAAGGCCCAGGCTTTGAAGCGG + Intronic
1081136167 11:39442348-39442370 GGCAGGCCCTGCACTTGGAGCGG - Intergenic
1083531975 11:63431387-63431409 GGAGCTGCCTTCCTTTGGAGGGG - Intergenic
1083592336 11:63903095-63903117 GGAATTCCCCACTTTTGGAGCGG + Exonic
1083777275 11:64900379-64900401 GAAAACCCCTGCCTTTGTAGTGG - Intronic
1084085444 11:66852968-66852990 AGGAGGCCCTGGCTTTGGAGAGG - Intronic
1084411450 11:69008488-69008510 GGAGGTCCCTCCCTTTGCAACGG - Intronic
1084707685 11:70824786-70824808 GGAACTGCCTGTCATTGGAGGGG + Intronic
1089774293 11:120825613-120825635 GGCAGTCCCTGCCCTTGGGGAGG + Intronic
1090509972 11:127364123-127364145 GGAACTGCGTTCCTTTGGAGGGG - Intergenic
1091129043 11:133128552-133128574 TGTAGTCCCTGCCAGTGGAGAGG + Intronic
1092070529 12:5627834-5627856 AGTAGTCCCAGCATTTGGAGAGG + Intronic
1093478159 12:19577978-19578000 GGAAATCCAAGCCTTTGAAGAGG + Intronic
1093710084 12:22320415-22320437 GGAAGGAGCTGCCTTGGGAGTGG + Intronic
1095065140 12:37762791-37762813 GGAACTGCATTCCTTTGGAGGGG - Intergenic
1095488303 12:42707158-42707180 GGAAGTCCCTGCAGATGCAGGGG - Intergenic
1096560267 12:52431102-52431124 CCAGGTCTCTGCCTTTGGAGGGG + Intronic
1097188075 12:57206209-57206231 GGAAGTCTCTGGGTCTGGAGGGG + Intronic
1098811889 12:75105010-75105032 AGAAGTCCCTGCCCTCAGAGAGG + Intronic
1100366787 12:93928942-93928964 CGAAGTAACTGCCTTTTGAGAGG + Intergenic
1104365380 12:128171803-128171825 GGAAGACACTGCCTTTTTAGGGG - Intergenic
1104575030 12:129958958-129958980 AGGAGTCCCTGCCTTTGAATTGG + Intergenic
1104689899 12:130818006-130818028 GGAAGGCCCTGCAGTGGGAGGGG + Intronic
1107362258 13:39632350-39632372 GGAAGTCACTTCAGTTGGAGGGG + Intergenic
1108558998 13:51624836-51624858 GGACGTTCCTGCCTTTGCACTGG - Intronic
1112630949 13:101160756-101160778 GAAAGTCCCTGTCTTTGGCCCGG - Intronic
1112899871 13:104345395-104345417 GGAACTGCATTCCTTTGGAGGGG + Intergenic
1113173453 13:107533514-107533536 GGACTTCCCTGCCTTTTGAATGG + Intronic
1117734056 14:58751529-58751551 GGGACGCCCTGCCTGTGGAGAGG + Intergenic
1119080982 14:71693248-71693270 GGTAATCCCTGCCCTTGGGGAGG + Intronic
1119982209 14:79094323-79094345 TGTGGTCCTTGCCTTTGGAGTGG - Intronic
1120853207 14:89189300-89189322 GGAAGTCCCTGCCTTTGGAGTGG - Intronic
1122721527 14:103725112-103725134 TGAAGTCCCTGCTGTTAGAGCGG + Intronic
1122774586 14:104111625-104111647 GGAGGTGGCAGCCTTTGGAGAGG - Intronic
1122782713 14:104150359-104150381 GGAAATCCAGGCCTCTGGAGTGG + Intronic
1123052219 14:105550180-105550202 GAAGGTCCGTGACTTTGGAGAGG + Intergenic
1128665333 15:69533374-69533396 GGAAGAGCCTGCCTGTGCAGTGG + Intergenic
1132802039 16:1759246-1759268 GGCAGACCCTGCCTGTGGGGAGG + Intronic
1135324159 16:21515360-21515382 GGGAGACCCTGCCCTTGTAGGGG - Intergenic
1136335640 16:29608632-29608654 GGGAGACCCTGCCCTTGTAGGGG - Intergenic
1136407587 16:30057525-30057547 CAAAGCCCCTGCCCTTGGAGTGG + Intronic
1136782629 16:32917011-32917033 GCATGTCCCTGCCTTTGCTGTGG + Intergenic
1136887165 16:33936839-33936861 GCATGTCCCTGCCTTTGCTGTGG - Intergenic
1136997794 16:35202670-35202692 GGAACTGCCTGTCTTAGGAGGGG - Intergenic
1137010602 16:35316515-35316537 GGAACTGCCTGTCTTAGGAGGGG - Intergenic
1137024199 16:35456829-35456851 GGAACTTCCTGTCTTAGGAGGGG - Intergenic
1137781871 16:51104116-51104138 TGAAGTGCGTGCCCTTGGAGGGG - Intergenic
1140444506 16:75014267-75014289 GGCAGTCGTTCCCTTTGGAGAGG - Intronic
1141768811 16:86076244-86076266 GCCAGTCCCTGCCCTTGGTGGGG + Intergenic
1203085287 16_KI270728v1_random:1180999-1181021 GCATGTCCCTGCCTTTGCTGTGG + Intergenic
1145905809 17:28515623-28515645 GGAAGTCTATACTTTTGGAGGGG - Intronic
1146681781 17:34813586-34813608 GGGAGGCCCTGGCTCTGGAGTGG + Intergenic
1147910625 17:43853867-43853889 GGAAGTCCCTGGCAATGGAGGGG - Exonic
1148584775 17:48769628-48769650 GGAGCTCCCAGTCTTTGGAGGGG - Intronic
1149936830 17:60816082-60816104 GGACATCCCTCCATTTGGAGAGG + Intronic
1149975436 17:61261186-61261208 GGAAGTACCTCCCTGGGGAGCGG + Intronic
1151314858 17:73315595-73315617 CTAAGCCCCTGACTTTGGAGAGG + Intergenic
1151922803 17:77170269-77170291 GGCAGTCCATGACTCTGGAGAGG + Intronic
1152374630 17:79912846-79912868 GGAAGCCCCTGCCCTCAGAGGGG + Intergenic
1153325657 18:3817420-3817442 GGAAGTGACTTCCATTGGAGTGG + Intronic
1154340352 18:13497710-13497732 GGAAAGCCCTCCCTTTGGGGAGG + Intronic
1155295688 18:24382453-24382475 TGTAGTCCCAGCCATTGGAGAGG + Intronic
1157374764 18:47152210-47152232 TCCAGTCCCTCCCTTTGGAGGGG - Intronic
1158165528 18:54535402-54535424 GGACGTGCCTGCATTTGTAGTGG - Intergenic
1160456596 18:79006354-79006376 GGAAGACCCGGCCCTGGGAGCGG + Intergenic
1163157182 19:15445891-15445913 GGAAGGCCCAGGCTTTGGGGTGG + Intronic
1163294657 19:16404536-16404558 GGAAGCCCCTGCCTGTGCATAGG + Intronic
1167089000 19:47330436-47330458 GGAAGCCCCCTCCTTGGGAGAGG - Intergenic
925904075 2:8528882-8528904 GAATGTCCCTGACATTGGAGAGG - Intergenic
926907374 2:17818023-17818045 AGAAGTAAATGCCTTTGGAGGGG - Intergenic
927112758 2:19876034-19876056 GGAAGCCCCTCCCATGGGAGGGG + Intergenic
927558749 2:24053985-24054007 GGACAGCCCTGCCTTGGGAGGGG - Intronic
929014613 2:37481943-37481965 GGGACACCCTGCCTGTGGAGAGG + Intergenic
929311901 2:40435264-40435286 GGAAGTGCTTGCCTTGGTAGTGG - Intronic
929489706 2:42385362-42385384 CACAGTCCCTGCCTTTGGAAGGG - Intronic
931491585 2:62754036-62754058 GGAGCTCCGTTCCTTTGGAGGGG + Intronic
934754414 2:96815890-96815912 GGAAGTTCCCGGCTTGGGAGCGG - Intergenic
938068223 2:128293106-128293128 GCAAGGCCCAGCCTTTGGGGAGG - Intronic
938902503 2:135809736-135809758 TGAAGGCTCTGACTTTGGAGGGG + Exonic
940987395 2:160062712-160062734 AGAAATTCCTGCCTTTGGGGTGG + Intergenic
941465723 2:165824156-165824178 GGAAGATCCTGCTTTTGAAGTGG - Intergenic
942847963 2:180448567-180448589 GGAAGTCCCTGCCATGATAGAGG + Intergenic
943123192 2:183763494-183763516 AGAAGTCCCTACCCTTGGGGAGG + Intergenic
943371404 2:187021151-187021173 GGTAATCCCAGCATTTGGAGAGG + Intergenic
946518588 2:220441089-220441111 GAAAGTAGCTGCCTTTGGAAAGG - Intergenic
946818568 2:223606906-223606928 GGCAGGCCCTGCCTTTGCAAGGG - Intergenic
947825329 2:233102324-233102346 GGAAGCTGCTGCCTTTGAAGGGG + Intronic
949045868 2:241872419-241872441 GGGAGCCCCGGCCTTTGAAGAGG - Exonic
1168962633 20:1879704-1879726 GGAAGTCCCTGGCTTAGCTGTGG - Intergenic
1169630253 20:7622731-7622753 GGCAGGCCCTGCACTTGGAGCGG - Intergenic
1172273252 20:33666486-33666508 GGAAGTTCCTGGTTGTGGAGAGG - Exonic
1172855771 20:38001091-38001113 GGAACTCCCTGTCTTTTGTGGGG - Intronic
1174370701 20:50085490-50085512 GGGAGCCCCTGCCTTTGAGGGGG - Intronic
1175312839 20:58023946-58023968 AGGAGACCCTGCCTGTGGAGAGG - Intergenic
1175552256 20:59825124-59825146 CAAAGTCTCTGCCCTTGGAGGGG + Intronic
1175769968 20:61617370-61617392 CGAGGTCCCTGCGTTTGGAGAGG + Intronic
1175936125 20:62514882-62514904 GGAGGTCCCTTCCCTGGGAGAGG + Intergenic
1175945774 20:62558038-62558060 GGAGGACTCTGCCTTTGGGGAGG + Intronic
1176311879 21:5154873-5154895 AGAAGGCCCCGCCTTGGGAGGGG - Intergenic
1177875353 21:26625670-26625692 GGAACTACCTGCCTGTGGACAGG - Intergenic
1179574883 21:42301743-42301765 AGAAGCCCCTGTCTTTGCAGGGG - Intergenic
1181560619 22:23697558-23697580 GGAACTGCCTGCCCTTGGAGAGG - Intronic
1182438317 22:30345712-30345734 GGCAGTCCCTCCTTTTGCAGTGG - Intronic
1184604812 22:45566314-45566336 GGAACTCCCTGCCTCCTGAGGGG + Intronic
1184676913 22:46048371-46048393 GGAAGGCCCTGCATTCGGAAGGG - Intergenic
1184795245 22:46728377-46728399 CAGAGTCCCTGCCTTTGAAGAGG + Intronic
1185385912 22:50531284-50531306 GGAAGTACCTGCCTGCGGGGCGG + Exonic
949915748 3:8963268-8963290 GGAGGTCCCTCCCTTTGAGGAGG - Intronic
949997075 3:9626567-9626589 CCAAGTCCCCACCTTTGGAGTGG + Intergenic
950414649 3:12861982-12862004 GGAAGTGCCAGCCCTTTGAGAGG + Intronic
950446398 3:13041333-13041355 GGAAGTCCCTGCTCTTGGGAGGG - Intronic
950560769 3:13721165-13721187 GGAAATCTCTGCCTTTTGATTGG + Intergenic
953147427 3:40291344-40291366 GGAACTACCTGCCTTTGGGTAGG - Intergenic
956096455 3:65721319-65721341 GGAAGTCCCTGCCTCAGAAGAGG - Intronic
956981198 3:74640739-74640761 GAAAGACCCTGTTTTTGGAGGGG - Intergenic
957043222 3:75353030-75353052 AGAAGTGCCTGCCTTTTGAAGGG + Intergenic
958654519 3:96984096-96984118 GGAACTGCATTCCTTTGGAGGGG + Intronic
958906142 3:99944140-99944162 AGAACTCCCTCCCTTTGGTGAGG - Intronic
962119123 3:132543517-132543539 GCAAGTCCCTGCCACTGGAAGGG - Intergenic
962479745 3:135788048-135788070 GGAAGTACCTGAATTGGGAGGGG - Intergenic
963032135 3:140988651-140988673 GGAGCTCCATTCCTTTGGAGGGG - Intergenic
965984614 3:174736426-174736448 GGGACACCCTGCCTGTGGAGAGG - Intronic
968703321 4:2066849-2066871 GGAAGCCTCTGTTTTTGGAGTGG + Exonic
971001894 4:22332671-22332693 GGATTTCCCTGGCTTTGGATAGG + Intergenic
971882577 4:32396953-32396975 TGAAGTCAATGCCTTTGGAAGGG - Intergenic
972779869 4:42277934-42277956 GAAATTCCCTGCCTTTGAAAGGG + Intergenic
973542868 4:51952360-51952382 GGAGCTGCCTTCCTTTGGAGGGG + Intergenic
973565482 4:52182477-52182499 TGCAGTCTCTGCCTTTGGATTGG - Intergenic
974220394 4:58962004-58962026 GGAAGTCTCTGAATTTGGTGAGG + Intergenic
974420170 4:61662830-61662852 GGAATGACCTGCCTGTGGAGAGG + Intronic
976086104 4:81408727-81408749 TGGAATCCCTCCCTTTGGAGTGG + Intergenic
978750335 4:112239028-112239050 TCAAGTCCCTGCCTTCTGAGTGG + Intronic
982178398 4:152727995-152728017 GGAAGTCCCTGAAGTAGGAGAGG + Intronic
984636719 4:182119040-182119062 GTAAGTCTGTGCCTTTGGACTGG + Intergenic
986919010 5:12661982-12662004 GGCAGGCCCTGCACTTGGAGTGG + Intergenic
987441976 5:17967532-17967554 GGAACTACCTGCCTGTGGATAGG - Intergenic
987488843 5:18551981-18552003 GGTAGGCCCTGCTTTTGAAGTGG - Intergenic
990517205 5:56541509-56541531 TGTAGTCCCTGCCTCTGGGGAGG + Intronic
991527441 5:67576868-67576890 TGAAGTCACTGCCTTTGGGAGGG - Intergenic
991967708 5:72108441-72108463 AGAAGTCCCAGCCTCGGGAGTGG + Intronic
996019784 5:118578462-118578484 GAAAGTCCTTGCCTTTAAAGAGG + Intergenic
997354067 5:133251171-133251193 GCATGACCCGGCCTTTGGAGAGG + Intronic
998014288 5:138720131-138720153 GCAAGGCCCTGCCTATTGAGGGG + Intronic
998171434 5:139874059-139874081 GGAAGGCCCTGCCATTACAGAGG - Intronic
1001313983 5:170629904-170629926 CCAAGTCCCTGCCTTAGGATGGG - Intronic
1001490435 5:172150966-172150988 GGACGTGCCTGCCCTTGGTGGGG - Intronic
1001570176 5:172725668-172725690 GGATCTCACTGCCTTTGGAGGGG - Intergenic
1003271097 6:4608734-4608756 GGTATTCCCTGACTTTGGGGAGG + Intergenic
1004880496 6:20002671-20002693 GGAAGACCCGGCCTTTTGGGAGG + Intergenic
1005322489 6:24668514-24668536 GTAAATCCCTGCTTTTGGCGGGG - Intronic
1005587458 6:27290876-27290898 GGAGATCCCTGCCTTTAAAGGGG + Intronic
1005805978 6:29474969-29474991 GGCAGTCCCTGCCTTTGTGGAGG + Intergenic
1005849258 6:29807219-29807241 GGAAGTCACTGACTCTGGATTGG - Intergenic
1006039349 6:31241202-31241224 GAAAGTGACTGCATTTGGAGAGG - Intergenic
1007833653 6:44657618-44657640 GGAAGTCTTTGACTCTGGAGTGG + Intergenic
1008126295 6:47673085-47673107 GGCAGTAGCTTCCTTTGGAGGGG + Intronic
1013009193 6:106104937-106104959 AGAGGTCCTTTCCTTTGGAGGGG - Exonic
1013119121 6:107125898-107125920 GGAAGTCCCTGGGGTTGGGGAGG - Intergenic
1013288160 6:108698236-108698258 GGAAGCCTCTGCCTCTAGAGGGG - Intergenic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1015096179 6:129417298-129417320 GGAATTACCTGCCTGTGGAACGG - Intronic
1016566896 6:145465513-145465535 GGAACTGCGTTCCTTTGGAGAGG + Intergenic
1019587443 7:1813143-1813165 GGAGATCCCTGGCTGTGGAGGGG + Intergenic
1019862063 7:3668397-3668419 GGAAGTCCATGCCCATGGAGAGG - Intronic
1022357934 7:29633209-29633231 GGAAGTGACTGCGTTTGGTGTGG + Intergenic
1022368201 7:29745853-29745875 GGAAGTGACTGCGTTTGGTGTGG + Intergenic
1022876236 7:34533573-34533595 GGAAGTGGCTGCCTTTGCAGAGG - Intergenic
1023116690 7:36869667-36869689 GGAAGTATTTGCCCTTGGAGAGG - Intronic
1023377974 7:39577488-39577510 GGCAGGCCCTGCACTTGGAGTGG + Intronic
1023688654 7:42763536-42763558 GGATGTCCCTGCACTTGCAGAGG - Intergenic
1024517049 7:50267993-50268015 GGAGGGCACTGCCTTGGGAGGGG - Intergenic
1026889354 7:73973167-73973189 GGAAGTCCCTGACCTGAGAGAGG + Intergenic
1026910663 7:74089967-74089989 GGGTGTACCTGGCTTTGGAGTGG + Intronic
1028789748 7:94840563-94840585 GGAAGTCACTTCAGTTGGAGAGG + Intergenic
1029746244 7:102517251-102517273 GGAAGACCCTTCCTTTGCGGGGG + Intronic
1029764182 7:102616230-102616252 GGAAGACCCTTCCTTTGCGGGGG + Intronic
1030646890 7:112071739-112071761 GGATGTCCTTGCCTTAGCAGAGG + Intronic
1031000544 7:116409820-116409842 GGAACTGCGTTCCTTTGGAGGGG - Intronic
1031392498 7:121232636-121232658 GGAACTCCCTGCCTTCCCAGAGG + Intronic
1033130752 7:138743609-138743631 TGAAGTCCCTTCCTTGGGAGAGG + Intronic
1033141137 7:138827557-138827579 GGAAGTCACTGCAGATGGAGTGG + Intronic
1033276331 7:139974304-139974326 GGCAGTGCCTGCCTCTGGTGAGG - Intronic
1034900127 7:154903165-154903187 GTAAGGGCCTCCCTTTGGAGAGG - Intergenic
1035221523 7:157409285-157409307 GGATGGCCCTGCCTTGGGCGGGG + Intronic
1036735452 8:11310921-11310943 GGAAGTCTCTGCCTTTGAGGTGG - Intronic
1037875652 8:22546403-22546425 GGGATTCCCTCCCTTGGGAGGGG - Intronic
1037981466 8:23257536-23257558 ACAGGTCCCTGCCTTTGCAGAGG + Intronic
1039440347 8:37590847-37590869 AGAATTCCCTGCTTTTGGTGGGG - Intergenic
1039913653 8:41844170-41844192 GCCTGTCCCTGCCTTTTGAGAGG + Intronic
1040390033 8:46941795-46941817 GGAACTGCCTTCCTTTGGAGGGG - Intergenic
1040637160 8:49288547-49288569 GGAAGCCCCTTCCTTTCCAGTGG - Intergenic
1043199743 8:77351696-77351718 TGAGGTCGCTGCCTTTGGAGAGG - Intergenic
1047537809 8:125735292-125735314 GGACTTCCCTGCCTTTGGGTAGG + Intergenic
1048997210 8:139801441-139801463 GGGAGCCCATGCCTATGGAGAGG + Intronic
1049973795 9:842821-842843 GGAATTCCCTGCCCTGAGAGCGG - Intronic
1051553449 9:18356155-18356177 GGATGTTCCTGCCTTTGGGTAGG - Intergenic
1057947873 9:99345262-99345284 GAAACTCCCTGCCATTAGAGAGG + Intergenic
1058164334 9:101603585-101603607 AGATGTCCCTGCCTTTGAGGAGG + Intronic
1059705627 9:116820714-116820736 AGCAGTCAATGCCTTTGGAGTGG + Exonic
1061495960 9:130974273-130974295 AGAAGTCCCTGAGGTTGGAGAGG - Intergenic
1062025200 9:134337038-134337060 GGGTGCCCCTGCCTGTGGAGAGG + Intronic
1062049780 9:134441254-134441276 GGAAGTCCCTGCCTTTCAGGTGG - Intergenic
1062446385 9:136597118-136597140 GGCCCTCCCTGCCTTGGGAGAGG + Intergenic
1186214461 X:7283942-7283964 GCAAGTTCCTGGCGTTGGAGAGG + Intronic
1186472453 X:9832210-9832232 GGAGCTCCCTGCCTCTGGACAGG - Intronic
1189209818 X:39275692-39275714 GGCAGGCCCTGCACTTGGAGCGG + Intergenic
1190263929 X:48816381-48816403 TGAAGTCCCTGTCTTAGGGGTGG + Intronic
1192202979 X:69078589-69078611 GGCAGCCCCTGCCTCTGGAGGGG - Intergenic
1192674975 X:73185929-73185951 GGAACTGCATTCCTTTGGAGGGG - Intergenic
1193025500 X:76841577-76841599 GGAACTGCGTTCCTTTGGAGGGG - Intergenic
1193406172 X:81105452-81105474 TGATGTCCCTTCCTTTGAAGTGG + Intergenic
1195111735 X:101657106-101657128 GGGAGCCCCTGCCATTGCAGGGG + Exonic
1197251077 X:124217031-124217053 GAAAGGTCCTGCCTTTAGAGAGG - Intronic
1198295746 X:135284621-135284643 GGAAGTGACTGCCTTTAGATGGG - Intronic
1201590772 Y:15611968-15611990 GGAACTGCGTTCCTTTGGAGAGG - Intergenic
1201942205 Y:19472577-19472599 GGAGCTGCCTTCCTTTGGAGGGG + Intergenic