ID: 1120858782

View in Genome Browser
Species Human (GRCh38)
Location 14:89235760-89235782
Sequence TTGTCTGTGAAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1521
Summary {0: 1, 1: 3, 2: 48, 3: 372, 4: 1097}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120858777_1120858782 -8 Left 1120858777 14:89235745-89235767 CCTGACCCGCTGTGGTTGTCTGT 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG 0: 1
1: 3
2: 48
3: 372
4: 1097

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120858782 Original CRISPR TTGTCTGTGAAGATGGAGGA TGG Intronic
900607110 1:3528707-3528729 TAGGCTTTGAGGATGGAGGAGGG + Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900783354 1:4632056-4632078 CTGGCTTTGAAGACGGAGGAGGG - Intergenic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
900908896 1:5580201-5580223 TTGGATGTGAAGATGAAGGCTGG + Intergenic
900937931 1:5778770-5778792 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
900961234 1:5922133-5922155 CTGCCTTTGAAGATGGAAGAAGG + Intronic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
901826031 1:11861936-11861958 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
901884239 1:12211534-12211556 CTATCTCTGAAGATGGACGAAGG - Intergenic
902247384 1:15129744-15129766 CTGGCTGTGGAGATGGAGGAAGG + Intergenic
902275787 1:15338355-15338377 CTGGCTTTGAAGATGGAGGAAGG - Intronic
902293596 1:15451105-15451127 CTGGCTCTGAAGATAGAGGAAGG + Intergenic
902998877 1:20250063-20250085 GTGGCTTTGAAGATGGAAGAAGG + Intergenic
903090795 1:20914412-20914434 CTGGCTTTGAAGATGGAGGAAGG + Intronic
903565535 1:24262549-24262571 TGTTCTTTGAAGATGGAGGAAGG - Intergenic
903622026 1:24704788-24704810 TTGTCTGGGAAGACGGGGGGAGG - Intergenic
903655218 1:24944718-24944740 TGGGCTTTGAAGGTGGAGGAAGG + Intronic
903677870 1:25076046-25076068 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
903757450 1:25672510-25672532 CTGGCTTTGAAGATGGAGGAAGG - Intronic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904534806 1:31192229-31192251 TTGGGTGTGAGGATGAAGGAAGG - Intronic
905235786 1:36546968-36546990 TCAGCTTTGAAGATGGAGGACGG + Intergenic
905310623 1:37046530-37046552 TTGTCAGGGAACCTGGAGGATGG - Intergenic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
905526355 1:38642943-38642965 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
905737584 1:40340517-40340539 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
905737965 1:40343767-40343789 CTAACTTTGAAGATGGAGGAAGG - Intergenic
905936702 1:41829957-41829979 TTTTCTGGGAAAATGAAGGAGGG - Intronic
906837218 1:49096907-49096929 CTGGCTCTGAAGATGAAGGAAGG + Intronic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
907804682 1:57806430-57806452 TGCTCTGTGAAGATGAAGGCAGG + Intronic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
907933094 1:59018349-59018371 CTGACTTTGAAGATGAAGGAAGG + Intergenic
908022202 1:59909483-59909505 CTGGCTTTGAAGATGAAGGAGGG + Intronic
908096783 1:60747630-60747652 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
908209648 1:61887185-61887207 TAGTCTGTGGAGATGGTGGAGGG + Intronic
908269697 1:62410952-62410974 CTGTCTTTGAAAATGGAGAAAGG - Intergenic
908382877 1:63613090-63613112 TTGTTTGTGTATATGGAGCATGG + Intronic
908441687 1:64161563-64161585 TTGTCTCTGACCATGAAGGATGG - Intronic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
908808304 1:67953534-67953556 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909072848 1:71017275-71017297 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
909089563 1:71208457-71208479 TTGTCTGTGAATGTGTAGTATGG - Intergenic
909363785 1:74796349-74796371 TTGGCTTTGAAAATGGAGGAAGG + Intergenic
909369506 1:74867699-74867721 CTGGCCTTGAAGATGGAGGAAGG - Intergenic
909556891 1:76963970-76963992 ATGTTTTTGAAGATAGAGGAGGG + Intronic
910047572 1:82936388-82936410 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
910144774 1:84067025-84067047 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
910158801 1:84251718-84251740 TTGGTTTTCAAGATGGAGGAAGG + Intergenic
910205170 1:84742531-84742553 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910205272 1:84743286-84743308 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
910207800 1:84765205-84765227 TTGACTTTGAAGATGGAGGAAGG - Intergenic
910240010 1:85076118-85076140 CTGGCTGTGAAGAGGAAGGAAGG - Intronic
910400438 1:86832705-86832727 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910508300 1:87975740-87975762 TTATCTCTGAAGATGGAGGAAGG - Intergenic
910961650 1:92770025-92770047 CTGGGTTTGAAGATGGAGGATGG + Intronic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911351233 1:96758359-96758381 CTGTCTTTGAAAATGGAGGAGGG + Intronic
911740310 1:101379789-101379811 TTTGCTTTGAAGATGGAGGAAGG - Intergenic
912015760 1:105033500-105033522 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
912024542 1:105151481-105151503 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
912336021 1:108863639-108863661 TTGCTTTTGAAGATGAAGGAAGG - Intronic
912851730 1:113131836-113131858 GTGTGTGTGAAGATGGAATAGGG + Exonic
912913388 1:113786544-113786566 TATACTTTGAAGATGGAGGAAGG + Intronic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
914050115 1:144124457-144124479 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
914129067 1:144840994-144841016 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
914348511 1:146820083-146820105 CTGTCTTTGAATGTGGAGGAAGG - Intergenic
914828069 1:151149886-151149908 TTTTCTCTGAAGACGGATGAGGG - Intergenic
914916051 1:151819870-151819892 TGGACTGGGAGGATGGAGGATGG - Intronic
915014312 1:152719075-152719097 TTGTCTGGGCAGAAGGAAGAAGG + Intergenic
915238968 1:154506292-154506314 TTAGCTTTGAAGATGGAGGAAGG - Intronic
915647320 1:157282489-157282511 TTGGCCTTGAAGATGGAGTAAGG - Intergenic
915822503 1:159039810-159039832 TTTTCTGTGAAGTCTGAGGATGG - Intronic
915939524 1:160109910-160109932 TTGTTTGTGAGCATGGAGGCAGG - Intergenic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916173061 1:162015757-162015779 TTGGCTGTTAACATTGAGGAAGG + Intronic
916248589 1:162712682-162712704 TTGACTGTGAAGAGGGAAGTGGG + Intronic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
916704882 1:167339108-167339130 CTGGCTTTGAAGATGGAGGAAGG - Intronic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916908441 1:169316687-169316709 GTGGCTTTGAAGATGGAGAAAGG + Intronic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917063485 1:171066362-171066384 TTCTTTTTGAAGATGGAGGTAGG + Intergenic
917268048 1:173242717-173242739 TGGTTTTTGAAGATGGAGGGAGG + Intergenic
917277119 1:173342648-173342670 TCATCTGTTAAGAGGGAGGAGGG - Intergenic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918124463 1:181570669-181570691 CTGACTCTGAAGATAGAGGAAGG - Intronic
918204395 1:182296396-182296418 TTGCCTGAGAGGATGGGGGAGGG - Intergenic
918260093 1:182787914-182787936 GTGTGTGTGAAGAGGCAGGAGGG - Intergenic
918370556 1:183857202-183857224 CTGGCTTTGAAGATGGAGGAAGG + Intronic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
918418252 1:184335016-184335038 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
918524117 1:185446550-185446572 TTGTCAGTGAAGAGGGTGGCTGG + Intergenic
919267452 1:195288994-195289016 TTATCTCTGAAGATGGAGGAAGG + Intergenic
919392314 1:197002620-197002642 TTGTATGTAAAGATGGACGATGG + Exonic
919470807 1:197976983-197977005 TTATCTATGTAGCTGGAGGATGG + Intergenic
919482786 1:198109885-198109907 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
919662108 1:200257388-200257410 CTGGCTTTGAAGATGGAGAACGG + Intergenic
920447858 1:206033484-206033506 CTGACTGTGAAGACAGAGGAAGG - Intergenic
920521602 1:206631658-206631680 TTGGTCTTGAAGATGGAGGAGGG - Intergenic
921412446 1:214850232-214850254 CTGCCTTTGAAGATAGAGGATGG + Intergenic
921892673 1:220368761-220368783 TTGTTTGTGAAGCTTGAGAAAGG - Intergenic
922511953 1:226176104-226176126 GTGGCTCTGAAGATGGAGGAAGG + Intronic
922549724 1:226485141-226485163 TGTGCTGTGAAGATGCAGGAGGG + Intergenic
922559794 1:226561001-226561023 TAGACAGTGATGATGGAGGAAGG - Intronic
922564949 1:226595749-226595771 CTGGCGGTGATGATGGAGGAAGG + Intronic
922591677 1:226782076-226782098 TGTACTTTGAAGATGGAGGAAGG - Intergenic
923057439 1:230437566-230437588 TGCACTTTGAAGATGGAGGAAGG - Intergenic
923286242 1:232498647-232498669 CTTGCTGTGAAGATGGAGGAAGG - Intronic
924213103 1:241790976-241790998 CTGGCTTTGAAGATGAAGGAAGG - Intronic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924381838 1:243472463-243472485 TTGCCTGTGAGAAAGGAGGAAGG - Intronic
924530353 1:244888641-244888663 CTGGCTTTGAACATGGAGGAAGG + Intergenic
924587836 1:245375516-245375538 TTGGCTTTGATGATGGAAGAAGG + Intronic
924632345 1:245752755-245752777 GTGGATGTGAAGCTGGAGGAAGG - Intronic
924718309 1:246599453-246599475 CTGGCCTTGAAGATGGAGGAAGG - Intronic
924870205 1:248034274-248034296 TTGTCTGTGAAGAATGATGGTGG - Intronic
1063091227 10:2867632-2867654 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1063269749 10:4494654-4494676 TTGTGTGAGAAGCTGGATGAGGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1064076503 10:12273160-12273182 TTGTCTGTGAGGGTTGAAGAAGG + Intergenic
1064706220 10:18075044-18075066 GTGGCTTTGAAGATGAAGGAAGG + Intergenic
1065794738 10:29295797-29295819 CTGGCTGTGAAGATGGAGTAAGG + Intronic
1065947997 10:30624934-30624956 CTGGCTGTGAAGATGGAGTAAGG + Intronic
1066120985 10:32287063-32287085 TTCTCTATGAACATTGAGGAGGG - Intronic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1067299305 10:44994589-44994611 GTGTCTGTGATGATGGAGCTGGG - Exonic
1067373603 10:45707290-45707312 TGGAATGTGAAGATGGATGAAGG + Intergenic
1067380086 10:45764937-45764959 TGGAATGTGAAGATGGATGAAGG - Intronic
1067412885 10:46079943-46079965 TTGGTGGGGAAGATGGAGGAAGG + Intergenic
1067454250 10:46404938-46404960 CTGCCTTTGAGGATGGAGGAAGG - Intergenic
1067632953 10:47979694-47979716 CTGCCTTTGAGGATGGAGGAAGG + Intergenic
1067881426 10:50049061-50049083 TGGAATGTGAAGATGGATGAAGG + Intergenic
1067887785 10:50105592-50105614 TGGAATGTGAAGATGGATGAAGG - Intronic
1067894145 10:50161548-50161570 TTGATTTTGAAGATGGATGAAGG - Intergenic
1067954700 10:50778713-50778735 TTGATTTTGAAGATGGATGAAGG + Intronic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068606063 10:59006266-59006288 TCATCTGTGAAGCTGGAGGGAGG + Intergenic
1068780755 10:60916934-60916956 CTGGCTTTGAAGATGAAGGAAGG + Intronic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1069018726 10:63462671-63462693 TTGGCTTTTAAGATGGAGGAAGG + Intronic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069310091 10:67024196-67024218 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1069531154 10:69220528-69220550 TTGTCCGTGAAGAAGGAGCTGGG - Intronic
1069815630 10:71191931-71191953 TGGTCTGTGAAGAGACAGGAAGG + Intergenic
1070261171 10:74857366-74857388 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070448916 10:76537572-76537594 CTGGCTCTGAAAATGGAGGAAGG - Intronic
1070472424 10:76796004-76796026 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
1070512864 10:77177028-77177050 CTGGCTGTGAAGGTGGAGAAAGG + Intronic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1070633311 10:78104045-78104067 TTGGCTTTGAAGATGAAAGAGGG + Intergenic
1070658522 10:78288093-78288115 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1070839027 10:79470355-79470377 TTGTGTGTGATGATGGTGGGAGG + Intergenic
1071167525 10:82823717-82823739 TTGTCTGAGATGAGGGAAGAGGG - Intronic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1071805616 10:89117279-89117301 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1071806104 10:89122911-89122933 CTGGCTTTGAAGCTGGAGGAAGG - Intergenic
1071945252 10:90636613-90636635 TTGTCTGTGAAGTGGGAGGGAGG - Intergenic
1071948777 10:90678811-90678833 TTGTCTGTGAGGATGCATTAAGG + Intergenic
1071979300 10:90987565-90987587 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072169594 10:92846976-92846998 CTAGCTTTGAAGATGGAGGAAGG + Intronic
1072177079 10:92937107-92937129 TTATCTGTGATCAAGGAGGAAGG - Intronic
1072489129 10:95886628-95886650 TTGACTTTGAAGATGAAGGAAGG + Intronic
1072543348 10:96414897-96414919 TGGTCTGGGAACAAGGAGGAGGG - Intronic
1072910511 10:99496847-99496869 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1072911889 10:99509497-99509519 CTGGCTTTGAAGATGGAGGCAGG + Intergenic
1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG + Intronic
1073080293 10:100855530-100855552 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1073307241 10:102512889-102512911 TTTTCTGTAGAGATGGGGGAGGG - Intronic
1073604363 10:104879334-104879356 TTGCCTTTGAAGATGGAGACAGG - Intronic
1073673368 10:105617320-105617342 TTGGCTTCAAAGATGGAGGAAGG + Intergenic
1074150334 10:110753846-110753868 CTGTCTTTGAGGATGGAGAAGGG - Intronic
1074153175 10:110776530-110776552 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1074202995 10:111256435-111256457 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074439026 10:113458846-113458868 TTGGTTTTGAAGATGGAAGAAGG - Intergenic
1074471007 10:113726705-113726727 CTGGCTTTGAAGATGAAGGAAGG - Intronic
1074494038 10:113963434-113963456 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1074538011 10:114342620-114342642 TTGGCTTTGGGGATGGAGGAAGG + Intronic
1074771361 10:116736652-116736674 TGGGCTTGGAAGATGGAGGAAGG + Intronic
1075173562 10:120138448-120138470 TTGGCTTTGAAGAGGGAGGAAGG + Intergenic
1075264362 10:120988202-120988224 CTGGCTTTGAAGACGGAGGAAGG - Intergenic
1075272513 10:121064658-121064680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1075320904 10:121491168-121491190 TTCGCTGAGAAGATGGTGGAGGG - Intronic
1075378995 10:122003376-122003398 TTGTCAGTGAAAATGAAAGAAGG - Intronic
1075393540 10:122110993-122111015 CTGACTTTGAAGATGAAGGAAGG - Intronic
1075448612 10:122531223-122531245 TGGGCTTTGAAGATGGAGGAAGG + Intergenic
1075508850 10:123052343-123052365 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1075515653 10:123106044-123106066 CTGGCTTTGAAGATGCAGGATGG + Intergenic
1075580066 10:123610727-123610749 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
1075682796 10:124344322-124344344 CTGGCTGTGAAGCTGGAGGAAGG - Intergenic
1075884409 10:125885502-125885524 TGGGCTTTGAAGGTGGAGGAAGG + Intronic
1075903423 10:126061689-126061711 TTGGCCTCGAAGATGGAGGAAGG + Intronic
1076071328 10:127492338-127492360 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1076292445 10:129357147-129357169 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1076776993 10:132703387-132703409 TTGTGTGTGAAGATGGCCGAGGG - Intronic
1077290301 11:1786636-1786658 CTGGCTTTGAAGATGGAGGTGGG - Intergenic
1077342849 11:2033676-2033698 TTGTCTGTGAAGGTGGTGGCTGG - Intergenic
1077470287 11:2755138-2755160 ATGGCTCTGAAGATAGAGGAAGG - Intronic
1077482434 11:2822101-2822123 CTGGCTTTGAAGACGGAGGAGGG + Intronic
1077743567 11:4875567-4875589 TTGACATTGAAGATGAAGGAAGG - Intronic
1078018406 11:7635035-7635057 GAGTCTGGAAAGATGGAGGAGGG + Intronic
1078060136 11:8038027-8038049 TTGTCTGGGTTGGTGGAGGAAGG + Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078616131 11:12867885-12867907 TTGCCTGGGAAGATGTAGGAAGG + Intronic
1078919278 11:15813265-15813287 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1079414068 11:20216504-20216526 TTGGCTGTGAAGAGGGAGGAAGG - Intergenic
1079635343 11:22731994-22732016 ATGTCAGGGAAGATGCAGGAGGG + Intronic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079685548 11:23354862-23354884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079764719 11:24377554-24377576 TTGGCTTTGAGAATGGAGGAGGG + Intergenic
1079946671 11:26751540-26751562 GTGGCTTTGAAGATGGAGAAAGG + Intergenic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080247890 11:30199977-30199999 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080415695 11:32068043-32068065 TTAGCTTTGGAGATGGAGGAAGG + Intronic
1080615158 11:33939345-33939367 CTGACTTTGAAGCTGGAGGAAGG + Intergenic
1080709737 11:34735149-34735171 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1081293975 11:41362814-41362836 CTGGCTGTGAAGATGAAGGAAGG - Intronic
1081400666 11:42638454-42638476 TTGTCTGTAAAGAGGCATGAGGG - Intergenic
1081878894 11:46430929-46430951 TTGTCTGAGAACAGGGAGCAAGG - Intronic
1082757400 11:57091749-57091771 TTGTTGGTGAGGAAGGAGGAAGG - Intergenic
1082984977 11:59160744-59160766 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1083861625 11:65423120-65423142 TGGTCTGTGTGGAAGGAGGAAGG + Intergenic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1084800664 11:71541640-71541662 CTCTCTGGGTAGATGGAGGAGGG + Intronic
1084935826 11:72586170-72586192 TCGTCGGTGAACCTGGAGGAGGG + Exonic
1085021697 11:73214089-73214111 TTGTCTGTCAAGTGGGAGAATGG - Intergenic
1085342310 11:75740980-75741002 CTACCTGTGGAGATGGAGGAAGG - Intergenic
1085739720 11:79068628-79068650 CTGTCTGTGAAGGGGGAGAAGGG + Intronic
1085858285 11:80201154-80201176 ATGTGTGTGAGGATGGGGGAGGG - Intergenic
1085967741 11:81549041-81549063 GTGGCTTTGAAGATGGCGGAAGG + Intergenic
1086055996 11:82647105-82647127 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
1086151500 11:83615693-83615715 TTGATTCTGAAGATGGAAGAAGG + Intronic
1086560861 11:88167487-88167509 TTGGCAGGGAAGCTGGAGGAGGG + Intronic
1087101320 11:94367997-94368019 ATGGCTTTGAAGCTGGAGGAAGG + Intergenic
1087332930 11:96805619-96805641 CTGGCTTTGAAGACGGAGGATGG - Intergenic
1087463389 11:98473178-98473200 CTGGCTTTGATGATGGAGGAAGG - Intergenic
1087871544 11:103299561-103299583 TTGGCTTTAAGGATGGAGGAAGG - Intronic
1087956974 11:104300430-104300452 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1088200789 11:107331484-107331506 TTGGCTTTGAAGATGAAGGAAGG + Intronic
1088266976 11:107997241-107997263 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1088419130 11:109622857-109622879 TTGTCTGTGAACATGGAATGAGG + Intergenic
1088706075 11:112465871-112465893 TTGTGTTTGTAGATGGAGCAAGG + Intergenic
1088968693 11:114751922-114751944 ATGGCTTTGAAGATGGAGAATGG + Intergenic
1089068815 11:115682718-115682740 CTGGCTTGGAAGATGGAGGAAGG + Intergenic
1089147959 11:116344131-116344153 CTTACTCTGAAGATGGAGGAAGG - Intergenic
1089310106 11:117552332-117552354 GTGTCTGTGTAGATTGGGGATGG - Intronic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1089691761 11:120191260-120191282 TTGTCTTTGAAGCGGGAGGAGGG + Intergenic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1089949566 11:122512672-122512694 GTGACTTTGAAGATGGAGGAAGG - Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1090231446 11:125109368-125109390 TTGCCTCTGCAGAGGGAGGAAGG + Intronic
1090448466 11:126785067-126785089 TTGCCTGTGAAGATGAAGTAGGG + Intronic
1090731251 11:129574890-129574912 CTGTATTTGAAGCTGGAGGAAGG - Intergenic
1091130609 11:133143941-133143963 TACTCTGTGGAGATGGAGGAGGG + Intronic
1091312142 11:134582163-134582185 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1202825835 11_KI270721v1_random:88865-88887 TTGTCTGTGAAGGTGGTGGCTGG - Intergenic
1091604325 12:1937139-1937161 TTGTCAGTGTAGATGCAGGTGGG - Intergenic
1092001576 12:5036988-5037010 CTGGCTTTGATGATGGAGGAGGG + Intergenic
1092654559 12:10671488-10671510 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1092870184 12:12799436-12799458 CAGGCTTTGAAGATGGAGGAAGG - Intronic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093338840 12:17946182-17946204 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1093421248 12:18977360-18977382 TGCACTCTGAAGATGGAGGAAGG - Intergenic
1093522001 12:20061798-20061820 TTGTTTGGGAAAATGGAGGCTGG + Intergenic
1093702876 12:22242338-22242360 TTGTCAGAAAAGATGGACGATGG - Intronic
1094718655 12:33038744-33038766 TTGGCTTTGGAGATGGAGAAAGG - Intergenic
1095173333 12:39060782-39060804 TTATCTGTGGAGATGGAAGTAGG + Intergenic
1095236487 12:39802322-39802344 ACGTATGTGAAGATGGTGGAAGG + Intronic
1095242275 12:39875298-39875320 TTGGCTTTGAAGACTGAGGAAGG - Intronic
1096202966 12:49698992-49699014 TTTTCTTTGAAGATAGAGGAGGG - Intronic
1096230188 12:49892434-49892456 TGGGCTCGGAAGATGGAGGAGGG - Intronic
1096233196 12:49908930-49908952 TTGTCTGTGAACATGTGGGAGGG + Intergenic
1096418082 12:51431114-51431136 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1097290573 12:57911042-57911064 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097429851 12:59491436-59491458 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097485034 12:60185862-60185884 TTATCTGTGAACGTGGAGAAGGG - Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1098305650 12:69100000-69100022 CTTTCTGTGAGGATGGATGAGGG - Intergenic
1098638610 12:72814065-72814087 CTGACTTTGAAAATGGAGGAAGG - Intergenic
1098826464 12:75303891-75303913 AAGACTTTGAAGATGGAGGAAGG + Intronic
1098860312 12:75702385-75702407 TTATCTGGGAAGAAGCAGGAGGG + Intergenic
1099023787 12:77440259-77440281 TTGGCTTTGAAAATGGAGGAGGG - Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1099182557 12:79485014-79485036 TTGGCTTTGAAGATGGAGCAAGG - Intergenic
1099199844 12:79662806-79662828 TGGCATGTGAAGATGGAGTAAGG + Intronic
1099610347 12:84859908-84859930 TTGCCTTTAAAGATGGAGAATGG + Exonic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1099811424 12:87587322-87587344 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1099954994 12:89344905-89344927 TTCTCTGCGGAGAAGGAGGATGG + Intergenic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100198519 12:92273991-92274013 TGGTTTGTGAAGATGAAGGCAGG - Intergenic
1100397412 12:94197088-94197110 TTGGTTTTGAAGATGCAGGAAGG - Intronic
1100714657 12:97293326-97293348 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1100950002 12:99837151-99837173 TTGGCTCTAAAGATGGAAGAGGG + Intronic
1101023992 12:100582894-100582916 CAGGCTGTGAAGACGGAGGAGGG - Intronic
1101407708 12:104443271-104443293 GTGGCTTTGAAGATGGAGGATGG + Intergenic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102445757 12:113001601-113001623 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1102451070 12:113042547-113042569 CTGGCTGTGAAGATGAAGGTGGG + Intergenic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1102814208 12:115849886-115849908 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1102991632 12:117320378-117320400 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103042684 12:117708957-117708979 TGGACTTTGAAGTTGGAGGAAGG - Intronic
1103741508 12:123094646-123094668 GCATCTGTGCAGATGGAGGACGG - Intronic
1103799423 12:123527808-123527830 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1104074783 12:125379365-125379387 CTGGCTTTGAAGATGCAGGAAGG + Intronic
1104166837 12:126239889-126239911 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1104177307 12:126345400-126345422 TTGGCTTTGAGGATGAAGGAAGG - Intergenic
1104369869 12:128215113-128215135 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1104369994 12:128215971-128215993 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1104533220 12:129592755-129592777 ACGTTTGTGAAGATGGAGCAAGG + Intronic
1104597052 12:130127021-130127043 GTGGCTCTGAAGCTGGAGGAAGG + Intergenic
1104695178 12:130858055-130858077 CTGGCACTGAAGATGGAGGATGG - Intergenic
1105310112 13:19198977-19198999 ATGGCGGTGATGATGGAGGAGGG + Intergenic
1105483580 13:20803509-20803531 TTGGGAGTGAAGATGGAGAAAGG - Intronic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1105832510 13:24176673-24176695 TTTTCTGTGAAAATGGAGCTTGG + Intronic
1105881629 13:24611208-24611230 GTGACTGTGAAGATGGAAGAAGG - Intergenic
1106454725 13:29917133-29917155 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106544573 13:30718853-30718875 TTCTCTGTGAACTTGGGGGAGGG - Intronic
1106572523 13:30940186-30940208 TAGTCTTGGAAGATGGAAGAAGG + Intronic
1106670652 13:31901056-31901078 CTGGCTTTGAAGATGGATGAAGG - Intergenic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1107239839 13:38219155-38219177 TTGGCTTAGAAGATGGAGAAAGG - Intergenic
1107330499 13:39295021-39295043 TGGGCTTTGATGATGGAGGAAGG - Intergenic
1107366248 13:39680741-39680763 CTGGCTTGGAAGATGGAGGAAGG - Intronic
1107631836 13:42350711-42350733 TTGGCTTTGAAGATAGAGGAAGG + Intergenic
1107638473 13:42416925-42416947 TTGGCTTTGAAAATGGAGGAAGG + Intergenic
1107691775 13:42960775-42960797 CTGGCTTTGAAGATGTAGGAAGG - Intronic
1107702897 13:43066369-43066391 TTGGCTTTGAAAATGGAGGAAGG - Intronic
1107788367 13:43976801-43976823 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1107884932 13:44867350-44867372 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1108033071 13:46257124-46257146 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1108149428 13:47517176-47517198 CTGACTTTGAACATGGAGGAAGG - Intergenic
1108200843 13:48041391-48041413 TTGTCTGTGAACCTGGAAGTGGG + Intronic
1108581656 13:51833215-51833237 TTCTCTGTTATGATGGATGATGG - Intergenic
1108698906 13:52927015-52927037 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1108709215 13:53016544-53016566 CTGACTGTGAAGGTGGAGGAAGG + Intergenic
1108857046 13:54806370-54806392 TTGGCTTTGAAAATGGAGGAAGG - Intergenic
1109321440 13:60814678-60814700 TTGTTTGTGAAAATGGAAAATGG - Intergenic
1109349114 13:61154085-61154107 TTGTCTTAGAAGATGGAGGAAGG + Intergenic
1109491373 13:63104865-63104887 CTGGCTCTGAAGATGGTGGAAGG - Intergenic
1109656106 13:65392339-65392361 TTTTCTGTAAAAATGGAGGTAGG - Intergenic
1110056619 13:70982304-70982326 TTAGCTTTGAAGATGGAGGAAGG - Intergenic
1110408386 13:75176278-75176300 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1110409221 13:75185480-75185502 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1110442311 13:75539034-75539056 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1110574449 13:77039772-77039794 TCGGCTTTGAAGATGGAGGAAGG - Intergenic
1110741856 13:79007112-79007134 TTGTCTGTGTGCATGGAGAATGG + Intergenic
1110802945 13:79721387-79721409 CTGGCAGTGAGGATGGAGGAAGG + Intergenic
1110837525 13:80101599-80101621 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1111002147 13:82198330-82198352 TTGTAATAGAAGATGGAGGATGG + Intergenic
1111455998 13:88485183-88485205 TTAGCTTTGAAGATGGAGGAAGG - Intergenic
1111574728 13:90137683-90137705 CTGTCTTTGAAGATGAAGAAAGG + Intergenic
1111864337 13:93750161-93750183 TTGTCTGTAAAGACAAAGGAGGG + Intronic
1112005947 13:95253786-95253808 TTGTCTCTGAAGATGGATTTTGG - Intronic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112669609 13:101619424-101619446 CTGCCTTTGAAGATGGAGAAAGG + Intronic
1112769172 13:102776775-102776797 CTGGCTGAGAAGATGGAAGAGGG + Intergenic
1112927429 13:104693823-104693845 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1113043436 13:106128526-106128548 CTGGCTTTGGAGATGGAGGAAGG - Intergenic
1113096284 13:106667219-106667241 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1113612216 13:111655123-111655145 TGGGGAGTGAAGATGGAGGAAGG + Intronic
1113817251 13:113181661-113181683 TTATATGTTAAGCTGGAGGATGG - Intronic
1113948675 13:114059245-114059267 TGTGCTGTGAAGATGCAGGAGGG - Intronic
1113976291 13:114230212-114230234 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1114345915 14:21794905-21794927 CTGGCTTTGAAGATGGAGGGAGG + Intergenic
1114365170 14:22018386-22018408 TAGTCTGTGGAGATGGAGAAAGG - Intergenic
1114514790 14:23291598-23291620 TTTTCTGTAGAGATGGGGGACGG - Intronic
1114548775 14:23521701-23521723 GTGTCTGTGAAGATGGGCAAGGG + Exonic
1115162565 14:30412330-30412352 CTGGCTGTGAAGATGGAAGAAGG - Intergenic
1115495710 14:34002418-34002440 CTGGCTTTGACGATGGAGGAAGG + Intronic
1115649716 14:35394358-35394380 TGTTCTGGGAAGATGGTGGAAGG - Intergenic
1115697650 14:35917629-35917651 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1115998097 14:39214259-39214281 TTGGCTTTGAAGATAGAAGAAGG + Intergenic
1116001898 14:39252359-39252381 CTGGCTTTGAAAATGGAGGATGG + Intronic
1116260830 14:42623570-42623592 TTGTGTGGGAAGATGGGGGAGGG + Intergenic
1116370533 14:44125071-44125093 GTGGCTTTGAAAATGGAGGAAGG - Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1116739739 14:48739272-48739294 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
1116802307 14:49455553-49455575 TTGGCTTTAAAGATGGAGAAAGG + Intergenic
1117152270 14:52901617-52901639 CTGGCTTTGAAGATAGAGGAAGG + Intronic
1117363317 14:54999336-54999358 ATGCATGTGAAGATGGGGGAGGG + Intronic
1117712709 14:58548960-58548982 TTGTGTGTGGAGATGGGGGTGGG + Intronic
1117804175 14:59473374-59473396 TTTTCAGTGAAGATGGAGAAGGG + Intronic
1117835272 14:59798530-59798552 CTGGCTTTGAAGATGGAGAATGG - Intronic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118315013 14:64720865-64720887 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1118468537 14:66053800-66053822 TTGGCTTTGAAGACGGAGGAAGG - Intergenic
1118745120 14:68767872-68767894 TTGTCTGTGTAGAGAGAGCAGGG + Intergenic
1118814222 14:69298539-69298561 GTGTCTGTGAGGATGGAACATGG - Intronic
1119076477 14:71645117-71645139 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1119410613 14:74427705-74427727 GTGTCTGTGAAGATGAAGTATGG - Intergenic
1119433170 14:74581508-74581530 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119852536 14:77876262-77876284 CTGGCTGTAAAGATGAAGGAAGG - Intronic
1120038359 14:79724201-79724223 TTATCTTTGAGGATGGAGTAAGG - Intronic
1120219816 14:81719488-81719510 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
1120252087 14:82070175-82070197 CTGGCTTCGAAGATGGAGGAAGG + Intergenic
1120266498 14:82257717-82257739 TTGACTTTGAAGATGGCAGAAGG + Intergenic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1120836540 14:89042898-89042920 CTGGCTTTGAAGATGGAGGACGG + Intergenic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1121182498 14:91940002-91940024 TTGGCTTTGAGGATGGAGGGAGG + Intronic
1121291631 14:92780351-92780373 TTGTCTTTGAACATGGAGTGTGG - Intergenic
1121298196 14:92847322-92847344 TTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121717009 14:96083582-96083604 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1121727571 14:96164443-96164465 TTGTCTTTGAGGATGGAGGAGGG + Intergenic
1121911041 14:97792849-97792871 TTGACTGTCAGGATGGAGAATGG - Intergenic
1121958671 14:98238458-98238480 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1122020785 14:98836357-98836379 CTGGCTGCGAAGATGGAGGAAGG - Intergenic
1122349967 14:101083437-101083459 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1122373183 14:101240630-101240652 CTGGCTTTGAAGACGGAGGATGG + Intergenic
1122420927 14:101576886-101576908 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1122866777 14:104609449-104609471 CTGGCTTTGAAGATGGAGCAAGG - Intergenic
1122916096 14:104859666-104859688 TGGACGGTGGAGATGGAGGATGG - Intergenic
1122958128 14:105081983-105082005 TTGACTGTGAAGAGGCATGAGGG - Intergenic
1123126651 14:105951780-105951802 TGGCCTTTGAAGATGGAAGAAGG + Intergenic
1202904030 14_GL000194v1_random:58398-58420 TTGTCAGTGGTGATGGAGAAGGG + Intergenic
1123407161 15:20027881-20027903 TGGCCTTTGAAGATGGAAGAAGG + Intergenic
1123419978 15:20123720-20123742 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1123516491 15:21034537-21034559 TGGCCTTTGAAGATGGAAGAAGG + Intergenic
1123529199 15:21130256-21130278 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1124205239 15:27712932-27712954 CTGGCTATAAAGATGGAGGAGGG + Intergenic
1124884739 15:33674734-33674756 TTGTCTGTGAAGAATGTAGATGG + Intronic
1125167505 15:36725200-36725222 TTATCTGTGAAGGAGAAGGAAGG - Intronic
1125209555 15:37197383-37197405 TGGTCTTTGAAAATGGAGAAAGG - Intergenic
1125337201 15:38638517-38638539 TTGGCTGTAAAGATGGAGTCTGG + Intergenic
1126158355 15:45586093-45586115 TTGGCTTTGAATATAGAGGAAGG - Intergenic
1126318113 15:47392496-47392518 CTGGCTTTGAAGACGGAGGAAGG + Intronic
1126424722 15:48515078-48515100 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1126466985 15:48969785-48969807 CTGCCTTTGGAGATGGAGGAAGG + Intergenic
1126589038 15:50320837-50320859 TTGGCCTTAAAGATGGAGGAAGG + Intronic
1126729547 15:51668731-51668753 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
1126739166 15:51760382-51760404 TTTGCTTTGAAGATGGTGGAAGG - Intronic
1127210684 15:56771643-56771665 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1127272679 15:57415425-57415447 CTGGCGTTGAAGATGGAGGAAGG + Intronic
1127356088 15:58201374-58201396 TTGTCTTGGAAGATGGTGAAGGG + Intronic
1127591569 15:60430246-60430268 GTAACTTTGAAGATGGAGGAAGG + Intronic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128625729 15:69201009-69201031 CTGGCTTTGAAGATGAAGGAGGG - Intronic
1128934263 15:71731972-71731994 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1128949954 15:71868291-71868313 ATGTCTCTGAAGATGGAGAAAGG - Intronic
1129062078 15:72868198-72868220 GTGGCTTGGAAGATGGAGGAAGG - Intergenic
1129118944 15:73383261-73383283 AGGGCTTTGAAGATGGAGGAAGG + Intergenic
1129905285 15:79182948-79182970 TTGTCTCTGAAAAAGAAGGAAGG - Intergenic
1129912370 15:79239414-79239436 GTGTCTGTGCAGATGGAACAGGG + Intergenic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130260988 15:82354210-82354232 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130280247 15:82514808-82514830 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130471622 15:84230994-84231016 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130479116 15:84345565-84345587 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130492655 15:84442566-84442588 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130593918 15:85235622-85235644 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130613135 15:85379605-85379627 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1130711977 15:86292311-86292333 TTGGCTTTGAAGGTGGAGGGAGG + Intronic
1130712094 15:86293416-86293438 CTGGCTTTGAAGATGGAGAAAGG - Intronic
1130717961 15:86354950-86354972 TGGACTTTGAAGATGGAGGCAGG + Intronic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1130959672 15:88651515-88651537 CTGGCTTTGAAGATGGAGGGAGG - Intronic
1131396224 15:92088694-92088716 CTGGCTTTGAAGATGGTGGATGG - Intronic
1131465782 15:92654093-92654115 TGGTCTGAGAAAATGGAGAAAGG - Intronic
1131532293 15:93204356-93204378 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1131640726 15:94289983-94290005 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1131737193 15:95346431-95346453 TTGGCTTTGAACTTGGAGGAAGG + Intergenic
1131771488 15:95742689-95742711 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1132110953 15:99101976-99101998 ATGTCAGTGAATATGGAGTAGGG + Intronic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1132149794 15:99451455-99451477 TTGGCTGTGAAGGTGAAGGCAGG + Intergenic
1132319245 15:100913439-100913461 CTGGCTTTGAAGATGGAGGATGG - Intronic
1132879657 16:2156409-2156431 CTGTCTGTCTAGATGGGGGATGG - Intronic
1132930943 16:2459045-2459067 TTCTCTGTGAAGGAGGAGGCAGG - Intergenic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133120104 16:3601054-3601076 TGTGCTGTGAAGATGGAGGTTGG - Exonic
1133193736 16:4153585-4153607 TTGTGTGTGAAGGTGGGGCAGGG + Intergenic
1133209757 16:4256978-4257000 TATTCTGTAAAGATGGAAGATGG - Intergenic
1133214136 16:4280827-4280849 TGCACTTTGAAGATGGAGGAAGG - Intergenic
1133388235 16:5387949-5387971 TTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1133407578 16:5537664-5537686 TTGGCTTTGAAGATGGAGGCAGG - Intergenic
1133467509 16:6042025-6042047 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1133904068 16:10004641-10004663 CTTGCTTTGAAGATGGAGGAAGG - Intronic
1133921999 16:10161820-10161842 TGCACTTTGAAGATGGAGGAAGG - Intronic
1134099495 16:11441725-11441747 TTGGCTTTGAAGGTGGAAGAAGG + Intronic
1134119061 16:11570944-11570966 TTGGCTTTGAAGGGGGAGGAAGG + Intronic
1134217071 16:12324449-12324471 TTGTTTGTGGAGATGGAGTCAGG + Intronic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134488541 16:14678335-14678357 GTGGCAGTGAAGATGGTGGAAGG - Intronic
1134742229 16:16558121-16558143 CTGCCCTTGAAGATGGAGGAAGG + Intergenic
1134764419 16:16744257-16744279 GTTGCTTTGAAGATGGAGGAAGG + Intergenic
1134872775 16:17666824-17666846 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1134925335 16:18154335-18154357 CTGCCCTTGAAGATGGAGGAAGG - Intergenic
1134981639 16:18614957-18614979 GTTGCTTTGAAGATGGAGGAAGG - Intergenic
1135527037 16:23221463-23221485 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1136297935 16:29314242-29314264 TTGGATGTGAAGCTGGAGGCCGG + Intergenic
1136530835 16:30867887-30867909 CTGACTCTGAAGATGGAGGGAGG + Intronic
1137237265 16:46626160-46626182 TGGAATGTGAAGATGGTGGAGGG + Intergenic
1137253782 16:46758861-46758883 TTGTCTGAGAAGATGGGGAGAGG + Intronic
1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG + Intergenic
1137622771 16:49887155-49887177 CTGACTCTGAACATGGAGGAGGG - Intergenic
1137737403 16:50735199-50735221 CTGGCTCTGAAGGTGGAGGAAGG + Intergenic
1138395175 16:56698485-56698507 TGCTCTGTGACCATGGAGGAGGG - Intronic
1138535615 16:57658783-57658805 CTATCTGTGAAGTGGGAGGATGG - Intronic
1138639631 16:58374155-58374177 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1138756902 16:59498118-59498140 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1138894542 16:61187714-61187736 TTGACTTTGAAGATGGAAGGAGG - Intergenic
1139309457 16:66016193-66016215 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1139374568 16:66488739-66488761 CTGGCTTTTAAGATGGAGGAAGG + Intronic
1139466672 16:67157752-67157774 TTTTGTCAGAAGATGGAGGAAGG - Intronic
1139504480 16:67392199-67392221 GTGGGTGTGAAGATGGAGGATGG - Intronic
1139509668 16:67419960-67419982 TGGGCTTTGAAGATGGAGGAAGG + Intergenic
1139689297 16:68629688-68629710 TTGCCTGAGGAGCTGGAGGAAGG - Intergenic
1140051632 16:71486491-71486513 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140593998 16:76386951-76386973 TTGGCTTTGAAGATAGAGGAAGG + Intronic
1140619299 16:76708506-76708528 CTGACGTTGAAGATGGAGGAAGG + Intergenic
1140642356 16:76990975-76990997 TTGTCTTTGAAGATGAAAAAGGG - Intergenic
1140677068 16:77342939-77342961 CTGGCTTTGAAGATGAAGGAGGG + Intronic
1140700510 16:77577171-77577193 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1140725666 16:77809338-77809360 ATTTCTCTGATGATGGAGGATGG - Intronic
1140787062 16:78352480-78352502 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1140880555 16:79194435-79194457 TGGACTGTGAAGATGAAGAAAGG + Intronic
1141035894 16:80625289-80625311 TTGCCTTTGATGATGGAGGAAGG - Intronic
1141149206 16:81552539-81552561 GTGGCTCTGAAGATGGAGGAAGG - Intronic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1141191073 16:81824975-81824997 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1141222082 16:82080432-82080454 GTGGCTTTGAAGATAGAGGAAGG + Intronic
1141263348 16:82473717-82473739 CTGGCTTTCAAGATGGAGGAAGG - Intergenic
1141268661 16:82519727-82519749 TGTGCTCTGAAGATGGAGGAAGG + Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141317306 16:82974723-82974745 CTGTCTTTGAAGATAGAGGAAGG + Intronic
1141329980 16:83102094-83102116 CTGGCTTTGAAGATGAAGGAAGG + Intronic
1141372695 16:83502318-83502340 CTGGCTTTGAAGATGGAGCAAGG + Intronic
1141406037 16:83794013-83794035 CTGCCTCTGAAGATGAAGGAAGG + Intronic
1141471933 16:84244671-84244693 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1141478227 16:84288224-84288246 GTGGCTTTGGAGATGGAGGAAGG - Intergenic
1141601247 16:85127686-85127708 TTGTCTGTGGTGGTGGAGAAGGG - Intergenic
1141763433 16:86043840-86043862 AGGGCTGTGAAGATGGGGGAAGG + Intergenic
1141788199 16:86215771-86215793 TCGGCTCTGAAGATGGAGGAGGG - Intergenic
1142000410 16:87661153-87661175 CTGGCTCTGAAGGTGGAGGAGGG - Intronic
1142038660 16:87878465-87878487 TGGAGTGTGAAGATGGAGGCGGG + Intergenic
1142059581 16:88020747-88020769 TTGGATGTGAAGCTGGAGGCCGG + Intronic
1142103239 16:88286583-88286605 TTGTCAGTGCAGGTGGGGGAGGG + Intergenic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1142768062 17:2076746-2076768 GTGGCTGTGAGGCTGGAGGAAGG + Intronic
1142947617 17:3446056-3446078 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1143333712 17:6157343-6157365 TTGACTTTGAAGATGCAGAAAGG - Intergenic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1143813131 17:9488607-9488629 TTGTCTTTGAAGACGGAGGAAGG + Intronic
1144075022 17:11709780-11709802 TTGTGTGTGAAGGTGAAGGAAGG - Intronic
1144515519 17:15915193-15915215 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
1144938997 17:18923947-18923969 TTGTGGGTGATGTTGGAGGAAGG + Exonic
1146096701 17:29937121-29937143 TGGCCTGTGAAGAAGGTGGATGG - Intronic
1146491015 17:33282387-33282409 ATGGCTTTGAAGATGGAAGAGGG - Intronic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146753215 17:35401058-35401080 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1147323890 17:39661258-39661280 CTGTCTGTGGAGATGGGGGGTGG + Intronic
1147485129 17:40805444-40805466 CTGTCTTTGAAGATGAAGGATGG + Intergenic
1147783941 17:42964526-42964548 TTGTCTGCGCAGAAGCAGGAGGG + Intronic
1148557016 17:48584880-48584902 ATGTGTGTGAAGACGGACGAGGG - Intronic
1148577599 17:48722772-48722794 TTTTATGGGAAGAGGGAGGAAGG - Intergenic
1149018224 17:51933391-51933413 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149383180 17:56114897-56114919 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1150627540 17:66851136-66851158 TTCTCTAGGAAGGTGGAGGAGGG + Intronic
1150905552 17:69333013-69333035 CTGGCAGTGAAGATGGAGGAAGG + Intergenic
1150990659 17:70254521-70254543 TTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1151025488 17:70671749-70671771 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
1151139509 17:71977981-71978003 TTGGCTTTGAAGATGGAGAAGGG + Intergenic
1151189782 17:72389722-72389744 CTGGCTTTGAAGATGGTGGAAGG - Intergenic
1151307086 17:73269976-73269998 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
1151927817 17:77211679-77211701 GTGTGTGTGAAGATGGTGTATGG + Intronic
1152172582 17:78762757-78762779 CTGGCTTTGAAGATGCAGGAAGG + Intronic
1152284119 17:79402673-79402695 TTGTCTGTGAAACAGGAGGCTGG + Intronic
1152697975 17:81805766-81805788 TGGACTGTGAAGGTGGAGGGTGG + Intronic
1153070883 18:1103056-1103078 TTGGCTGTGAAGAGGGATGTGGG + Intergenic
1153082421 18:1243261-1243283 CTGTCTTTGAAGGTGGAGGAAGG + Intergenic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1153226327 18:2902820-2902842 TTGTGTGTGAAGGAGCAGGAGGG + Intronic
1153276910 18:3376553-3376575 CTAGCTGTGAAGATGGAGGAAGG - Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153327894 18:3840409-3840431 TTGGTTGTGAAGATGGAGAAAGG - Intronic
1153382967 18:4458560-4458582 TGCACTTTGAAGATGGAGGAAGG + Intergenic
1153557447 18:6330435-6330457 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1153842420 18:9018735-9018757 TTGGTTTTGAAGATGGAGGAAGG + Intergenic
1153993652 18:10421648-10421670 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1154301852 18:13201141-13201163 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1155298362 18:24406295-24406317 TTTTCTGTTAAAATGGAAGAGGG + Intergenic
1155341028 18:24814299-24814321 CTGGCTTTGAAGGTGGAGGACGG - Intergenic
1155366924 18:25058050-25058072 AAGTCTGTGAAGAGGGAGAAAGG - Intergenic
1155437024 18:25824192-25824214 CTGGCTTTGAAGATGGAGGCAGG - Intergenic
1155533239 18:26789330-26789352 TTGCCTGTGAAGAGAAAGGAGGG - Intergenic
1155677722 18:28449859-28449881 TGCACTTTGAAGATGGAGGAAGG - Intergenic
1155758047 18:29526609-29526631 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1155864713 18:30950898-30950920 CTGTCATTGAAGATGGAGGAAGG + Intergenic
1156121539 18:33848603-33848625 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1156259343 18:35430160-35430182 TTGGCTTTGACGATGAAGGAAGG - Intergenic
1156259488 18:35431744-35431766 TTGGCTTTGAAGATGAAGAAGGG - Intergenic
1156279425 18:35620507-35620529 TTGTTTCTGAGGAGGGAGGAAGG - Intronic
1156314197 18:35952027-35952049 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1156889159 18:42169923-42169945 TTGTCCATGAGGATGTAGGAAGG + Intergenic
1157015416 18:43706608-43706630 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157955063 18:52087702-52087724 TGGACTTTGAAGCTGGAGGAAGG - Intergenic
1158157055 18:54437888-54437910 GAGGCTGTGAAGCTGGAGGATGG - Intergenic
1158219320 18:55133893-55133915 CTGCCCTTGAAGATGGAGGAAGG + Intergenic
1158403418 18:57140911-57140933 GTGTCAGTGAAGAAGGAGGAAGG + Intergenic
1158827353 18:61238055-61238077 TGCACTTTGAAGATGGAGGAAGG + Intergenic
1158968257 18:62642614-62642636 TTGGCTTTGAAGATGGAAAAAGG + Intergenic
1158992672 18:62886004-62886026 ATGGCTGTGAAGCTGGAGAAAGG + Intronic
1159313590 18:66741171-66741193 ATGGCAGTGAAGATGGAGAAAGG - Intergenic
1159421393 18:68225274-68225296 CTGGCTGTGAATATGGAGGTTGG + Intergenic
1159491931 18:69147900-69147922 TTGTCTTTGGAGGTGAAGGAAGG - Intergenic
1159816099 18:73075351-73075373 CTGACTTTGAAAATGGAGGAAGG - Intergenic
1159916745 18:74194747-74194769 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1160015997 18:75141216-75141238 ATGGCTTTGAATATGGAGGAAGG + Intergenic
1160087970 18:75797001-75797023 TTGGCTTTGAAGATAGAAGATGG + Intergenic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160400979 18:78611304-78611326 TTGTGAGTGAAGCTGGGGGATGG - Intergenic
1160599025 18:79998478-79998500 TTGTGTGTGAAAAGGGAGAAAGG - Intronic
1160602927 18:80028097-80028119 TTGTGTGTGAAAAGGGAGAAAGG - Intronic
1160664042 19:314665-314687 TCGCCTGTGGAGATGGAGAAAGG - Intronic
1160743597 19:699459-699481 TTTTCTGAGACGCTGGAGGACGG - Intergenic
1160913464 19:1485857-1485879 TTGTTTTTGAAGATGGAGTCTGG - Intronic
1160958831 19:1708187-1708209 CTGGCTGTGGAGGTGGAGGAAGG - Intergenic
1161117211 19:2504382-2504404 CTGGCTGCGAAGGTGGAGGAAGG + Intergenic
1161124347 19:2547412-2547434 GTGTCTGTGAAGGGGGAGGAAGG - Intronic
1161139983 19:2641491-2641513 GTGGCTGTGAAGGGGGAGGAGGG + Intronic
1161174615 19:2833771-2833793 TTATCAGAGAAGATGGGGGATGG + Exonic
1161326908 19:3668437-3668459 GTGGCTGTGAAGAGGGAGGAAGG + Intronic
1161367894 19:3891572-3891594 TTGGCTGTGAAGGGTGAGGAGGG + Intronic
1161468378 19:4444525-4444547 ATGGCTGTGAAGGTGGAGGAAGG - Intronic
1161495957 19:4585702-4585724 TTGTCACTGAAGATCCAGGAGGG + Intergenic
1161553820 19:4929210-4929232 GTGTCCCTGCAGATGGAGGACGG + Exonic
1161567910 19:5013611-5013633 GTGGCTGTGAAGGGGGAGGAAGG - Intronic
1161568550 19:5017095-5017117 TTCCCTGTGCAGAGGGAGGAAGG + Intronic
1161589380 19:5122228-5122250 GTGGCTGTGAAGGAGGAGGAAGG - Intronic
1161655292 19:5510658-5510680 CTGGCTGTGAAGGTGGAGGAGGG - Intergenic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1161998094 19:7726794-7726816 CTGCCTTTGAAGATGGAAGAAGG + Intergenic
1162050701 19:8030846-8030868 CTGGCCGTGAAGGTGGAGGAAGG + Intronic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1162777623 19:12989569-12989591 TTGTGTGTGTGGATGAAGGATGG + Intergenic
1163501951 19:17681395-17681417 TTGTGTGTGATGTTGGTGGAGGG + Intronic
1164505236 19:28854754-28854776 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1164551816 19:29218434-29218456 TTGGTTGTGAAGATGAAAGAAGG + Intergenic
1164801414 19:31079860-31079882 TTTGCTGTCAAGATGGAGAAGGG - Intergenic
1165081132 19:33306806-33306828 TTGTTTGTCTAGTTGGAGGAAGG - Intergenic
1166284066 19:41812776-41812798 CTCGCTTTGAAGATGGAGGAAGG - Intergenic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166820539 19:45576694-45576716 CTGGCCTTGAAGATGGAGGAAGG - Intronic
1166921185 19:46230174-46230196 GTGTTTGGGAAGCTGGAGGAGGG + Intronic
1167297043 19:48657010-48657032 TTGGCCGTGAAGATGGAAAAAGG + Intergenic
1167758366 19:51427230-51427252 GTGGCTGTGAGAATGGAGGAAGG + Intergenic
1168206285 19:54852681-54852703 TGGGCTTTGAAGGTGGAGGAAGG + Intronic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
1202689504 1_KI270712v1_random:77020-77042 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
925015321 2:519939-519961 TAGACTGTGAAGATGGAGGCAGG + Intergenic
925232450 2:2245858-2245880 CTGGCTGTGAACATGGAGGCTGG + Intronic
925416735 2:3675503-3675525 TTATCTGTGAAGAGAGAGGTGGG + Intronic
925481944 2:4285255-4285277 CTGGCTTTGAAGATGAAGGAGGG + Intergenic
925899145 2:8496043-8496065 GTGTCTGTGAAGATGAGGAAGGG - Intergenic
926159093 2:10475390-10475412 TTGTCTGTGAAGGGGGCTGATGG + Intergenic
926503380 2:13681540-13681562 TGGTCTTGGAAGATGGAGGCTGG - Intergenic
926544776 2:14226072-14226094 TTGGCTTTGAATATGGAGGAAGG - Intergenic
926656092 2:15407964-15407986 CTGTCTTTGAAGATAGAGAAAGG - Intronic
926962766 2:18376942-18376964 TTGGCTGGGAAGAAGGAGAAAGG - Intergenic
927154547 2:20213879-20213901 CTGTGTGTGAAGGTGGGGGAGGG + Intronic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
927716741 2:25358144-25358166 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
927940036 2:27097762-27097784 TGGTGTTTGAAGATGGGGGATGG + Intronic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928309343 2:30196747-30196769 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
928363016 2:30680728-30680750 TTGGCTTTGGAGATGGAGGAAGG + Intergenic
928600251 2:32897428-32897450 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
928686888 2:33759242-33759264 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
929037762 2:37711191-37711213 GTGACTCTGAAGATGGAGGAGGG + Intronic
929054993 2:37868980-37869002 CTGGCTGTGAAGATGGCAGAGGG - Intergenic
929123491 2:38502326-38502348 TTTTCTTTGAAGCTGGAGGAAGG - Intergenic
929434611 2:41918944-41918966 TTGTTGGTATAGATGGAGGATGG + Intergenic
929501745 2:42495843-42495865 GTGTCTGTGAAGATGAAGAAGGG + Intronic
929551129 2:42892970-42892992 TTGTCTGTGGGGATGGGTGAGGG + Intergenic
929571502 2:43025892-43025914 CTGACTTTGAAGATGGAGGCAGG - Intergenic
929571908 2:43028009-43028031 TGCTCTTTGAAGATGGAGGAAGG - Intergenic
929572822 2:43033370-43033392 TGCTCTTTGAAGATGGAGGAAGG + Intergenic
929827900 2:45324013-45324035 ATGACTTTGAAGATGGAGGAGGG - Intergenic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
930590912 2:53324737-53324759 CTGCCTTTGAAAATGGAGGAAGG + Intergenic
930769251 2:55115326-55115348 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
930978646 2:57495003-57495025 TTGGCTTTGGAGATGGAGGAAGG + Intergenic
931003515 2:57819599-57819621 TTGACTGAGAAGATAGAGGAAGG + Intergenic
931019997 2:58033400-58033422 TTGGCTTTGAAGATGGAAGATGG + Exonic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931303110 2:61000590-61000612 TTTATTCTGAAGATGGAGGAAGG - Intronic
931500263 2:62856985-62857007 CTGGCTTTGAAGATGGAGGAAGG + Intronic
931794240 2:65694069-65694091 TTGTGTGTCAAAATAGAGGAGGG + Intergenic
931895962 2:66729927-66729949 TTTTCTTTATAGATGGAGGAGGG + Intergenic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932829475 2:74975113-74975135 CTGGCTTTGAAGATGGAGGGGGG + Intergenic
932849273 2:75168478-75168500 CTGGCTTTGAAGATGGAGGAAGG + Intronic
932872135 2:75412540-75412562 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
932920425 2:75907876-75907898 TTGGCTTTGAAGATATAGGAAGG - Intergenic
933143110 2:78817902-78817924 TTTTCTCTGAAGAATGAGGAAGG + Intergenic
933449192 2:82424743-82424765 CTGGCTTTGAAGTTGGAGGAAGG + Intergenic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
933940480 2:87240740-87240762 CTGGCTGTGAAGATGTGGGAAGG - Intergenic
933956930 2:87379072-87379094 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934061466 2:88298033-88298055 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
934106348 2:88698574-88698596 TTGTGTGTGATGATGGGGTAGGG + Intronic
934169422 2:89327230-89327252 ATGACTGTGAGGAAGGAGGAAGG + Intergenic
934197872 2:89855355-89855377 ATGACTGTGAGGAAGGAGGAAGG - Intergenic
934241051 2:90270962-90270984 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934272127 2:91545723-91545745 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
934502602 2:94871985-94872007 TTGTCAGTGGTGATGGAGAAGGG - Exonic
934537874 2:95151301-95151323 TTGGCTTTGAAGATGGACGAGGG + Intronic
934790236 2:97053654-97053676 GTGACTGTGAGGAAGGAGGAAGG - Intergenic
934816232 2:97328883-97328905 GTGACTGTGAGGAAGGAGGAAGG + Intergenic
934821464 2:97379601-97379623 GTGACTGTGAGGAAGGAGGAAGG - Intergenic
934843984 2:97649969-97649991 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
934926675 2:98386768-98386790 CTGGCTTTGAAGATGTAGGAAGG + Intronic
935091759 2:99901439-99901461 TCGGCTGTGAAGAGAGAGGAGGG - Intronic
935109321 2:100077375-100077397 TTGGCTTTGAAGATGGAGGATGG + Intronic
935109754 2:100081591-100081613 TTGTCTGTGAATATAGAACATGG - Intronic
935141539 2:100357554-100357576 CTGGCTTTGAAAATGGAGGAGGG - Intergenic
935296795 2:101656733-101656755 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
935391582 2:102558758-102558780 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
935674442 2:105582062-105582084 CTGGCTTTGAAGATCGAGGAAGG + Intergenic
935679612 2:105624653-105624675 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
935725867 2:106023598-106023620 CTGGCTCTGAAGGTGGAGGAAGG - Intergenic
935809364 2:106782009-106782031 TTTTCTGGGCAAATGGAGGAAGG + Intergenic
935963179 2:108447487-108447509 TTTTCTGAGATGATGGAGGCAGG - Intergenic
936125220 2:109783618-109783640 TTGTCTGTGAATATAGAACATGG + Intergenic
936148108 2:109995349-109995371 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
936196585 2:110376099-110376121 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
936219473 2:110587850-110587872 TTGTCTGTGAATATAGAACATGG - Intergenic
936341812 2:111640299-111640321 TTGGCTTTGAAGATGGGGGAAGG + Intergenic
936352657 2:111725036-111725058 CTGGCTGTGAAGATGTGGGAAGG + Intergenic
936381147 2:111987447-111987469 TTCTCTTTGAAGTTGGAGGCAGG + Intronic
937015541 2:118602098-118602120 CTGTCTGTGAGGGTGGAGGAAGG + Intergenic
937281163 2:120718141-120718163 TTGGCTTTGCAGATGTAGGAAGG - Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937426793 2:121806648-121806670 CTGGCATTGAAGATGGAGGAAGG + Intergenic
937600088 2:123721177-123721199 GTGGCTTTGAAGATGGAGGAAGG - Intergenic
937608553 2:123831942-123831964 TTGTCTGTGAAGTTGAAGTTAGG - Intergenic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938324454 2:130389061-130389083 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
938365980 2:130734665-130734687 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
938543401 2:132305238-132305260 TTGTCTCTGGAGATAGAGGATGG + Intergenic
938640885 2:133278392-133278414 TGGCTTTTGAAGATGGAGGAAGG - Intronic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
939462432 2:142514104-142514126 CTGCCTTTGAAGATGAAGGAAGG - Intergenic
939478334 2:142715493-142715515 AAGGCTTTGAAGATGGAGGAAGG - Intergenic
940214228 2:151288380-151288402 CTGGCCCTGAAGATGGAGGAAGG + Intronic
940341693 2:152588265-152588287 TTGGCTTTAAAGCTGGAGGAAGG - Intronic
940385439 2:153065766-153065788 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
940556920 2:155240543-155240565 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
941170243 2:162127083-162127105 TGGGCTTTGAGGATGGAGGAAGG + Intergenic
941520306 2:166534107-166534129 TTGTCTTTGAAAATGTAGTAAGG + Intergenic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
942889231 2:180966757-180966779 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943426310 2:187739781-187739803 TTGACTTTGAAGATGGAGGAAGG - Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943560563 2:189456628-189456650 ATGACTGTAAAGAGGGAGGAGGG + Intronic
943645577 2:190405949-190405971 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
943679537 2:190753309-190753331 TGTACTTTGAAGATGGAGGAAGG - Intergenic
943976529 2:194485479-194485501 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
944157478 2:196622457-196622479 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
945061798 2:205915818-205915840 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
945143277 2:206710362-206710384 GTGACAGAGAAGATGGAGGATGG - Intronic
945325546 2:208478424-208478446 TTGGCTTTGATGATGGAGGAAGG - Intronic
945501319 2:210578960-210578982 ATGTCTGTGATCATGGAAGAAGG - Intronic
945755262 2:213837897-213837919 CTGGCTTTGAAGATGAAGGAAGG + Intronic
946449558 2:219768222-219768244 TGGACTTTGAAGATGGAAGAGGG + Intergenic
946686338 2:222274932-222274954 TTGTCTGTGGATATGGAAAAGGG + Intronic
946715862 2:222554706-222554728 TTGTGTGGGAAGGTGGAGAAGGG + Intronic
946932370 2:224683493-224683515 CTGACTTTGAAGATAGAGGAAGG + Intergenic
946965033 2:225028274-225028296 CTGGCTTTGAAGATGAAGGAAGG + Intronic
947010278 2:225558456-225558478 TGGGCTTTAAAGATGGAGGACGG - Intronic
947246659 2:228055998-228056020 CTGTCATTGAAGATGGAGCAAGG - Intronic
947282386 2:228469769-228469791 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
947337438 2:229102051-229102073 CTGGCTTTGAAGATGGAGAATGG + Intronic
947425860 2:229982327-229982349 TTGGCTTTGCAGATAGAGGAAGG - Intronic
947950351 2:234141790-234141812 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
948036944 2:234865389-234865411 CTGGCTCTGACGATGGAGGAAGG - Intergenic
948115168 2:235490092-235490114 CTGACTTTGAAGATGCAGGAGGG - Intergenic
948125301 2:235560618-235560640 TTGGCTTTGATGATGGAGGGAGG + Intronic
948273519 2:236691569-236691591 CCGGCTTTGAAGATGGAGGAAGG + Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948345799 2:237297093-237297115 CTGGCTCTGAAGGTGGAGGAAGG - Intergenic
948345899 2:237297880-237297902 TGGCCTGTGAAGATGGCTGAAGG - Intergenic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
948532472 2:238618653-238618675 TTCTCTGTGGAGGCGGAGGAGGG + Intergenic
948668130 2:239548996-239549018 TTGGCTTTGAAGATGGGGGAGGG - Intergenic
948785552 2:240350609-240350631 CTGACGTTGAAGATGGAGGAGGG + Intergenic
948874580 2:240819923-240819945 TTCTCTGCGGAGATGGAGGAAGG + Intronic
949037422 2:241822232-241822254 CTGGGTTTGAAGATGGAGGAGGG + Intergenic
1168901314 20:1367503-1367525 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1169713511 20:8590671-8590693 CTGCCTTTGAAGTTGGAGGAAGG - Intronic
1170001105 20:11615367-11615389 TTGGCTCTGAAGCTGGAGGTAGG - Intergenic
1170045880 20:12084948-12084970 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1170129583 20:13004562-13004584 CTGACTTTGAAGATGGGGGAAGG + Intergenic
1170200226 20:13734900-13734922 TTGTCTAAGAACATGGAGGTAGG + Intronic
1170402408 20:16002567-16002589 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1170638823 20:18133873-18133895 TTGTTTGGGAAGAAGGTGGAGGG - Intergenic
1171177579 20:23064558-23064580 TTGGCTTTGAAGATGGAGCTAGG - Intergenic
1171872289 20:30538089-30538111 TTGTCTCTGGAGATAGAGGATGG + Intergenic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1172181340 20:33005556-33005578 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1172571195 20:35972185-35972207 CTGGCTGTCAAGATGAAGGAAGG - Intronic
1172669189 20:36622701-36622723 CTGGCTGTGAAGACTGAGGAAGG - Intronic
1172812836 20:37662042-37662064 CTGGCCTTGAAGATGGAGGAAGG - Intergenic
1172886630 20:38235552-38235574 CTGGCTTTGAGGATGGAGGAAGG + Intronic
1172925957 20:38535553-38535575 TTATCTCTGATAATGGAGGATGG - Intronic
1173108808 20:40165370-40165392 TTGGCTTTGAAGATGAAGAAAGG - Intergenic
1173149853 20:40557656-40557678 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173162923 20:40665652-40665674 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173488017 20:43455917-43455939 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1173554055 20:43953052-43953074 ACGGCTATGAAGATGGAGGAAGG + Intronic
1173573664 20:44095981-44096003 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173796033 20:45860599-45860621 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1174302987 20:49595614-49595636 CTGGCTTTGAAGATGGAGGTTGG - Intergenic
1174505662 20:51015906-51015928 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1174539779 20:51279845-51279867 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1174556711 20:51400738-51400760 ATGTCTGTGAGGATGAAGGAAGG - Intronic
1174628764 20:51938161-51938183 TTGTCTCTGAAGAGGGAAGATGG - Intergenic
1174845698 20:53941120-53941142 GTGTGTGTGAAGTGGGAGGAGGG + Intronic
1175287366 20:57845851-57845873 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175495971 20:59414503-59414525 CTGGCTTGGAAGATGGAGGATGG - Intergenic
1175597970 20:60250564-60250586 CTGGCTGGGATGATGGAGGAAGG + Intergenic
1175641748 20:60636015-60636037 CTACCTGTGAAGATGGAGGAAGG - Intergenic
1175692134 20:61073178-61073200 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1175700661 20:61134644-61134666 TTGTCTGTGAAGATGTCAAAGGG + Intergenic
1175711160 20:61222150-61222172 CTGGCTGTGAAGATGCAGGAAGG + Intergenic
1175764141 20:61581458-61581480 CTGGCCATGAAGATGGAGGAGGG - Intronic
1175989842 20:62782965-62782987 TTTGCTCTGAAGATGGAGGATGG + Intergenic
1176046467 20:63095362-63095384 CTGGCTCTGAAGACGGAGGATGG + Intergenic
1176427398 21:6557261-6557283 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1176934768 21:14853802-14853824 TTAGCTTTGAAGATGAAGGAAGG + Intergenic
1177318415 21:19491077-19491099 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1177615374 21:23510466-23510488 TTGTCTCTGAAGTTGTAAGAGGG - Intergenic
1178046957 21:28705828-28705850 TTGGCTTTGAAGATGGGGGAGGG - Intergenic
1178182564 21:30179638-30179660 GTGGCTTTCAAGATGGAGGACGG + Intergenic
1178258114 21:31073962-31073984 CTGGCTTTGAAGATGGAGGGAGG - Intergenic
1178273794 21:31217793-31217815 TTGGCTGGCATGATGGAGGAGGG - Intronic
1178279714 21:31270979-31271001 TTGTCATTTTAGATGGAGGAGGG - Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179008542 21:37535060-37535082 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179147252 21:38778929-38778951 CTGGCATTGAAGATGGAGGATGG + Intergenic
1179155767 21:38849773-38849795 TTCACTGTGAAGACAGAGGAAGG + Intergenic
1179164854 21:38927362-38927384 CAGGCTTTGAAGATGGAGGAAGG - Intergenic
1179240090 21:39582197-39582219 CTGGCTTTGAAGATGCAGGAGGG + Intronic
1179251742 21:39676383-39676405 TTGTCAGTGCAGATGGAGACTGG + Intergenic
1179266121 21:39805299-39805321 TCCTGTGTGAAGATGAAGGATGG + Intergenic
1179402832 21:41099966-41099988 CTGCCTTTGAAAATGGAGGAAGG - Intergenic
1179471664 21:41614424-41614446 TTGGCTTTGAAGAGGGAGGAAGG + Intergenic
1179533887 21:42038989-42039011 CTGGCCTTGAAGATGGAGGAGGG + Intergenic
1179542935 21:42095393-42095415 TTGACCTTGAAGATGGAGTAGGG - Intronic
1179553460 21:42157813-42157835 CTGCCTTTGAAGAGGGAGGAGGG - Intergenic
1179608535 21:42533860-42533882 TTGTCTGGGAGGTGGGAGGAGGG - Intronic
1179702889 21:43165578-43165600 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1179964844 21:44796869-44796891 CTGGCTGTGAAGATGGAAGAAGG - Intronic
1180849679 22:19009774-19009796 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1181021371 22:20105175-20105197 TTCTCTAAGAAGAGGGAGGAGGG + Intronic
1181024256 22:20118765-20118787 ATGTCTGTGAATCTGGGGGAGGG + Intronic
1181063201 22:20291832-20291854 GTGTGTGTGAAGAGGGAGGCAGG - Intergenic
1181352112 22:22266482-22266504 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1181664912 22:24387930-24387952 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1182000984 22:26919619-26919641 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
1182517314 22:30866279-30866301 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1183327916 22:37204455-37204477 TTTTGTGTGGAGATGGAGGCTGG - Exonic
1184374611 22:44103762-44103784 CTGGCTCTGAAGATGGAAGAAGG + Intronic
1184388027 22:44187310-44187332 TTGGACGTGAAGATGGAGGTGGG - Intronic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184742115 22:46434579-46434601 ATGTGTGTGATGGTGGAGGATGG - Intronic
1184923606 22:47622749-47622771 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1185181256 22:49364649-49364671 CTGGCTTTGGAGATGGAGGAGGG + Intergenic
949092253 3:42124-42146 TTGGTTTTGATGATGGAGGAAGG - Intergenic
949135149 3:555336-555358 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
949137957 3:593778-593800 TTAGCTGTGAATATGGAGGTGGG + Intergenic
949204141 3:1417686-1417708 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
949401396 3:3668681-3668703 ATGACTTTGAAGAAGGAGGAAGG - Intergenic
949777224 3:7646722-7646744 ATGTATGAGAAGTTGGAGGATGG + Intronic
950921584 3:16700277-16700299 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
951048964 3:18073049-18073071 TTATCTGTGGAAATGAAGGAAGG - Intronic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951051378 3:18097707-18097729 CTGGCTTTGAAGATGGAGGAAGG - Intronic
951110130 3:18793392-18793414 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
951313296 3:21157312-21157334 CTGACATTGAAGATGGAGGAAGG - Intergenic
951594444 3:24301896-24301918 TTGACTTTGAAGATGGAGGAAGG + Intronic
952190466 3:31017774-31017796 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
952721711 3:36540585-36540607 ATGGATGTGAAGATGGAGAAAGG + Intronic
953006700 3:38985542-38985564 ATGGCAGTGAAGATGGAGAAAGG + Intergenic
953373695 3:42410994-42411016 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
953379445 3:42456465-42456487 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
953791564 3:45951621-45951643 TGGTCAGTGTAGATGGTGGAGGG + Intronic
953857519 3:46511441-46511463 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
954623731 3:52010750-52010772 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
954661262 3:52228127-52228149 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
954732000 3:52672191-52672213 CTGGCTTTGAAGATGGAGGAAGG - Intronic
954874058 3:53789596-53789618 TGGCCTGTTGAGATGGAGGATGG + Intronic
955169573 3:56550194-56550216 TTGGCTTTGAAGATGGAGAAGGG - Intergenic
955205835 3:56895124-56895146 CTGTCTTTGAAAGTGGAGGAGGG - Intronic
955413172 3:58668994-58669016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
955463209 3:59208369-59208391 CTGCCTTTGAAGATGAAGGAAGG + Intergenic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956342831 3:68246030-68246052 TTGACTCTGAAGATAGAGCAGGG - Intronic
956606641 3:71079485-71079507 TTGTCTGTGTCGAGGGAGGATGG - Intronic
956775518 3:72562230-72562252 TGTGCTGTGAAGATGGAGGAAGG + Intergenic
956957780 3:74360754-74360776 CTGGCTGTGAAGATGAGGGAAGG - Intronic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957124276 3:76137756-76137778 TTGGCTTTGAAGATGGAGGTAGG - Intronic
957128996 3:76199252-76199274 CTGGCTTTGAAGATGTAGGAAGG + Intronic
957681658 3:83443841-83443863 ATGTCTGTGAAGAGTGATGATGG - Intergenic
958177732 3:90017992-90018014 TTCGCTTTGAAGATGGAGAAAGG - Intergenic
958787788 3:98617078-98617100 CTCACTGTGAAGATGGAGAAAGG - Intergenic
959029522 3:101281818-101281840 CTGTCTTTGAAGATGGAAGTGGG + Intronic
959191032 3:103112114-103112136 TTGACTCTGAAGAAGGAAGAAGG + Intergenic
959322031 3:104888780-104888802 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
959469274 3:106729600-106729622 TTTTCTTTGAATATTGAGGAAGG - Intergenic
959585793 3:108023953-108023975 CTGGCTCTGAAGATGGAAGAAGG + Intergenic
959747231 3:109790931-109790953 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
959848708 3:111063420-111063442 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
960324060 3:116273345-116273367 TTTTCTATTAAGATGGAGGCAGG - Intronic
960326683 3:116304846-116304868 TTGGTGGGGAAGATGGAGGATGG + Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
961356453 3:126342996-126343018 TTGTCTGGGAAACCGGAGGAGGG + Exonic
961578143 3:127855423-127855445 CTGGCTCTGAAGATGGAGGGAGG - Intergenic
961584900 3:127914449-127914471 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
961658261 3:128454946-128454968 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
961750384 3:129090852-129090874 TGGAATGTGAAGATGGTGGAGGG + Exonic
961939279 3:130620592-130620614 TTTTCTTTAAAGATGAAGGAAGG + Intronic
961990172 3:131181269-131181291 CTAGCTTTGAAGATGGAGGAAGG + Intronic
963006797 3:140734035-140734057 CTGGCTTTGAAGTTGGAGGAAGG - Intergenic
963127784 3:141831224-141831246 TTGTGTGTAGAGATGGAGAAAGG + Intergenic
963231377 3:142911574-142911596 GAGTCTGTGAGGCTGGAGGAAGG + Intergenic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963372533 3:144419484-144419506 CTGGCTTTGAAGATGGAGAATGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
964191420 3:154006229-154006251 CTGTCTTTGAAAATGAAGGAAGG - Intergenic
964219747 3:154329601-154329623 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
964509171 3:157431392-157431414 CTGGCTGTGAAGATGGAGAAAGG - Intronic
964539296 3:157761489-157761511 TTGGCTTTGAAGATGGAAGAAGG + Intergenic
964561083 3:157997323-157997345 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
964654912 3:159055599-159055621 CTGGCTTTGAAGATGGAGAAGGG - Intronic
964668442 3:159199335-159199357 TTGTCTTTAAAGTTGGAGGAAGG + Intronic
965186155 3:165467040-165467062 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965636580 3:170788243-170788265 CTGGCTTTGAAGATGGAGAAAGG + Intronic
965772090 3:172192074-172192096 TTACCTGGGAAGGTGGAGGAAGG + Intronic
965856335 3:173092556-173092578 CTGGCTTTGAAGACGGAGGAAGG + Intronic
966323435 3:178727625-178727647 CTGGCTTTGAAGATGGAGGAAGG + Intronic
966354870 3:179069231-179069253 TTATTTGTTAAGAAGGAGGAGGG - Intronic
967000231 3:185327177-185327199 CTGGCTTCGAAGATGGAGGAAGG - Intronic
967144938 3:186598511-186598533 ATGTGTGTGAAGGAGGAGGAAGG - Intergenic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967346930 3:188467728-188467750 CTGGCTTTGAAGATGGAGGAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967629236 3:191723913-191723935 TTGACTTGGAAGATGGAAGAAGG - Intergenic
968976078 4:3822692-3822714 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969429090 4:7143350-7143372 TTGTCTGGGGAGAGGGAGGAAGG + Intergenic
969968595 4:11022692-11022714 TTTTGTGTGAGGATGGATGAGGG + Intergenic
970018083 4:11535052-11535074 TTGCATTTGGAGATGGAGGAGGG + Intergenic
970398251 4:15692896-15692918 CTGGCTCTGAAGATGCAGGAAGG - Intronic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970473100 4:16395845-16395867 GGGTCTGTTAAGAAGGAGGAAGG + Intergenic
970527934 4:16951248-16951270 CTGGCTTTGAAGATGCAGGAAGG + Intergenic
970656803 4:18240227-18240249 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
970774099 4:19652236-19652258 CGGGCTTTGAAGATGGAGGAGGG - Intergenic
970821882 4:20226272-20226294 CTGGCTTTGAAGATGGAGGATGG + Intergenic
970938946 4:21608473-21608495 ATGCCTTTGAAAATGGAGGAAGG - Intronic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
971019946 4:22524274-22524296 TTGACTGAGAAGCTGCAGGATGG + Intergenic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
971454925 4:26835227-26835249 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
971680470 4:29692773-29692795 TTGTCTTTCAAGTTGGATGAAGG - Intergenic
971695811 4:29901529-29901551 TTGGCTTTGAAGATGGTAGAGGG + Intergenic
971810939 4:31425960-31425982 TTGTGTGTGCATATGTAGGATGG + Intergenic
971878972 4:32342908-32342930 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
972045970 4:34664576-34664598 TTGTGTCTGAATTTGGAGGAGGG + Intergenic
972233275 4:37099849-37099871 CTGACTATGAAGGTGGAGGAAGG + Intergenic
972247915 4:37265593-37265615 CTGGCACTGAAGATGGAGGAAGG - Intronic
972299225 4:37769411-37769433 TTGGCTTTGAAGATGGATGGGGG + Intergenic
972464576 4:39342861-39342883 CTGGCTTTGAAGATGCAGGAAGG - Intronic
972687935 4:41369183-41369205 TAGACTGGGAAGATGGGGGAGGG - Intronic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
972791430 4:42374957-42374979 CTGGCTTTGAAGATGGCGGAAGG - Intergenic
973184665 4:47311515-47311537 TGTGCTTTGAAGATGGAGGAAGG + Intronic
973329450 4:48897400-48897422 TTGGCCTTGAAGATGGAGGAAGG - Intronic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
974374402 4:61057947-61057969 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
974637389 4:64582668-64582690 GTGGCTGTTAAGAAGGAGGAAGG + Intergenic
975062533 4:70020172-70020194 CTGGCTTTGAACATGGAGGAAGG - Intergenic
975419836 4:74150062-74150084 TTGGCTTTGAAGATGGGGGAAGG + Intronic
975524979 4:75339181-75339203 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
975634973 4:76439188-76439210 CAGACTTTGAAGATGGAGGAAGG - Intronic
976069509 4:81224978-81225000 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
976223782 4:82779309-82779331 CTGGCTTTGAAGATGGAGGAAGG + Intronic
976392583 4:84520675-84520697 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
976694778 4:87907802-87907824 TGATCTGTGAACTTGGAGGATGG - Intergenic
976962571 4:90997252-90997274 CTGGCTTTGAAGATGAAGGATGG - Intronic
977334807 4:95684395-95684417 CTGGGTGTGAAGATGGGGGAAGG + Intergenic
977361933 4:96016294-96016316 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
977464601 4:97368029-97368051 CTTGCTTTGAAGATGGAGGAAGG - Intronic
977658207 4:99549209-99549231 CAGTCTGTCAGGATGGAGGAAGG - Exonic
977827108 4:101545967-101545989 TTAGCTTTGAAGATGGAGGAAGG - Intronic
978232785 4:106421067-106421089 CTGTCTTTGAAGACGGAGTAAGG + Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
979165573 4:117525743-117525765 TTGTATTTGAGGATTGAGGAGGG - Intergenic
979503706 4:121468943-121468965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
979845849 4:125510637-125510659 CTGACTTTGAAGATGGAGTAAGG - Intergenic
980082318 4:128357185-128357207 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
980102032 4:128551484-128551506 CTGGCTTTGAAGATGAAGGAGGG - Intergenic
980187472 4:129480029-129480051 TTGGCTTTGAAGATGGAATAAGG - Intergenic
980402089 4:132303851-132303873 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
980636667 4:135514662-135514684 TTATCTCTGAAGAGTGAGGATGG - Intergenic
981046897 4:140272982-140273004 TTTTCTCTGAACATGGCGGAAGG - Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981291598 4:143082728-143082750 CTGACTTTGAAGATGGAAGAAGG + Intergenic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
981701365 4:147610533-147610555 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
982030714 4:151297996-151298018 TTGGCTTTGAAGATAGAGCAAGG + Intronic
982525980 4:156478775-156478797 CTGGCTTTGAAGATGGTGGATGG + Intergenic
983711646 4:170724081-170724103 TTGTATGTGTACATGTAGGAGGG + Intergenic
983766064 4:171486245-171486267 TTGCCTCTGCTGATGGAGGATGG + Intergenic
984352905 4:178618820-178618842 TTGGCTTTGAAGATGGAGAAAGG + Intergenic
984809172 4:183779029-183779051 TTGTTTGTGGAAATGGAGGATGG - Intergenic
984884803 4:184440701-184440723 TTCTCTGTGAAGCTGGAGGCAGG - Intronic
985771908 5:1817169-1817191 TTGTCTTTGATGCTGGAGGCTGG + Intergenic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
986516675 5:8571688-8571710 TTGTCTCAGAAGGTGAAGGAGGG + Intergenic
986614309 5:9601078-9601100 GTCTCTTTGGAGATGGAGGACGG - Intergenic
986645296 5:9910969-9910991 TGGGCTTTGAAGATGGAGCAAGG - Intergenic
986664646 5:10090193-10090215 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
986822427 5:11482317-11482339 TTGTATGTGTAGGTGGTGGAGGG - Intronic
986855655 5:11865831-11865853 CGGTCTTTGAACATGGAGGAAGG + Intronic
986912080 5:12570374-12570396 GTGAATGTGAAGATGGAGGCAGG + Intergenic
986939519 5:12934450-12934472 TTGGCCTTGAAGATGGAGGAAGG + Intergenic
987103231 5:14611402-14611424 CTGGCTTTGAAGATGGAGGAAGG + Exonic
987239026 5:15973488-15973510 CTGGCTTTGGAGATGGAGGAAGG + Intergenic
987243100 5:16021136-16021158 ATGGCTTTGAAGATGGAGGTGGG - Intergenic
987274699 5:16350116-16350138 TTATCTCTGAAGAAGGAGGGAGG - Intergenic
987385482 5:17325110-17325132 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
988148018 5:27336203-27336225 TTGACTTTGAAGATGAGGGATGG - Intergenic
988371680 5:30377372-30377394 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
988440563 5:31228088-31228110 TTGGCTTTGAAAATGGCGGAAGG - Intronic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
988518798 5:31927934-31927956 ATCTTGGTGAAGATGGAGGAAGG - Intronic
989344296 5:40411865-40411887 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
989709044 5:44374153-44374175 TTGTCTTTGAAGATGGACAAAGG - Intronic
989725806 5:44585053-44585075 TTGCATTTGAAGATGGTGGATGG + Intergenic
990157981 5:52901197-52901219 TTGGCTTTAAAGATGGAGGGGGG + Intronic
990238720 5:53795695-53795717 TTCTCTGGGCAGATGGAGCAGGG - Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
990592591 5:57281509-57281531 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
990605618 5:57406949-57406971 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
990721576 5:58701714-58701736 TTGGCTATGAAGGTAGAGGAAGG - Intronic
991025182 5:62021521-62021543 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991404223 5:66286021-66286043 TTGGCTTTGATGCTGGAGGAAGG - Intergenic
991419629 5:66427964-66427986 TTGCCTTTGAAGATGGAAGAAGG + Intergenic
991598748 5:68331520-68331542 TTGCCTTTGAAGATGGAGGAAGG + Intergenic
991929176 5:71735184-71735206 TTGACTTTAAAAATGGAGGAAGG - Intergenic
992278217 5:75143465-75143487 CTGTCTGTTAAGAGGTAGGAAGG - Intronic
992615847 5:78545337-78545359 TTCTCTGTGAAGATCCAGCATGG + Intronic
992647871 5:78829014-78829036 CTGGCTTTGAAGATGGAGGAAGG + Intronic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
993878358 5:93335709-93335731 CTGGCTTTGAAGATGGAGAAGGG - Intergenic
994048273 5:95333230-95333252 TTGGCTCTACAGATGGAGGAAGG + Intergenic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
994591829 5:101783562-101783584 TTCTCTGTGAGGAAGGGGGAAGG - Intergenic
994750937 5:103736137-103736159 TTGGTTTTGAAGATGAAGGAAGG - Intergenic
994896224 5:105706912-105706934 TTTTTTTTTAAGATGGAGGAAGG + Intergenic
994930111 5:106171893-106171915 TTGGCTTTGAGGATGAAGGAAGG - Intergenic
995060156 5:107804862-107804884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995412404 5:111873572-111873594 CTTGCTTTGAAGATGGAGGAAGG - Intronic
995437788 5:112157590-112157612 CTGGCTTTGAAGATGTAGGAAGG - Intronic
995572565 5:113495740-113495762 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995783519 5:115803260-115803282 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996418265 5:123233481-123233503 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996470427 5:123853624-123853646 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996624755 5:125557312-125557334 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
996706808 5:126506184-126506206 TTGTTTGTGAAGTTGGAAGCAGG - Intergenic
996857897 5:128030567-128030589 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996945783 5:129065939-129065961 TTGGCCATGAAGATGGAGGCAGG + Intergenic
997096714 5:130921700-130921722 TTATCTGTGGGAATGGAGGAGGG - Intergenic
997261547 5:132469231-132469253 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
997902236 5:137777670-137777692 TTGACTTTGAAGATCGAGAAAGG - Intergenic
998039297 5:138942185-138942207 TTGGCTTTGAAGACAGAGGAAGG + Intergenic
998305080 5:141068132-141068154 GTGGCTTTGAAGATGAAGGAAGG - Intergenic
999403527 5:151286082-151286104 TGGTCTGTGATAATGGAGCATGG + Intronic
1000719784 5:164692540-164692562 TGTTCTTTGAAGATGGAGGAGGG + Intergenic
1000971645 5:167721550-167721572 CTGGCTTTGAAGATGAAGGAAGG - Intronic
1001233910 5:170013528-170013550 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1001244186 5:170093528-170093550 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
1001658161 5:173369983-173370005 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1001658562 5:173373269-173373291 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1001834630 5:174821425-174821447 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
1001899416 5:175412862-175412884 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1002340514 5:178513772-178513794 CTGACCGTGAAGATGGAGGGAGG - Intronic
1002447690 5:179299724-179299746 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1003027672 6:2571333-2571355 TGGACTTTGAAGATGGAGGAAGG - Intergenic
1003073099 6:2960054-2960076 CTGTCTGTGAAGGTGGAGATGGG - Exonic
1003115566 6:3281643-3281665 TTCTCTGTGAAGTGGGGGGATGG + Intronic
1003133135 6:3412826-3412848 CTGGCTCTGAAGACGGAGGATGG + Intronic
1003501591 6:6707721-6707743 TTTTCTTTGGTGATGGAGGATGG - Intergenic
1003692121 6:8365148-8365170 ATCTCTGTGCAGAGGGAGGATGG - Intergenic
1003915510 6:10782991-10783013 TTGTTTGGGAAGATGGGGCATGG - Intronic
1003949317 6:11103479-11103501 TTATCTGGGAAAATGGACGAAGG + Exonic
1003974203 6:11327500-11327522 TTGACTGTGAAGATACTGGAGGG - Intronic
1004176905 6:13347982-13348004 ATGTCTGTGAACATGGAGGGTGG + Intergenic
1004384358 6:15159631-15159653 TTGCCTGGGTAGATGGAGGATGG - Intergenic
1004789716 6:19011475-19011497 TTGGCTTTGAAAATTGAGGAAGG - Intergenic
1004876681 6:19962684-19962706 TACCCTGTGAAGATGGAGGAAGG + Intergenic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1005190563 6:23217072-23217094 TTGTGTGTGAACATGGTGGCAGG - Intergenic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006020216 6:31113336-31113358 TTGGCTTTGGAGATGGAGGAAGG - Intergenic
1006428009 6:33978153-33978175 TTATTTGTGAAGGAGGAGGAAGG + Intergenic
1006773250 6:36571523-36571545 CTGACTTTTAAGATGGAGGAAGG - Intergenic
1007465249 6:42047298-42047320 TAGCCTGTGCAGATGGAGTATGG + Intronic
1007895587 6:45354043-45354065 TTGTCAGGGAAGATGGAGGGAGG + Intronic
1008008067 6:46433587-46433609 TTGGCTTTGAAGTTGGAGGAAGG + Intronic
1008141697 6:47839464-47839486 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1008505767 6:52228279-52228301 GTGGCTTCGAAGATGGAGGAAGG - Intergenic
1008517966 6:52335987-52336009 TGCTGTGGGAAGATGGAGGAAGG - Intergenic
1008946317 6:57100958-57100980 TTGTGTCTGGAGATAGAGGATGG - Intronic
1009351499 6:62684860-62684882 TTGGTTTTGAAGATGGAAGAAGG + Intergenic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009804359 6:68583846-68583868 TTAGCTTTGAAGATGGAGGAAGG - Intergenic
1009965829 6:70577077-70577099 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1010068226 6:71710958-71710980 TTGGCTCTGAAGATGGAGAGAGG + Intergenic
1010321720 6:74518149-74518171 CTGTCTTTGAACATGAAGGAAGG + Intergenic
1010572697 6:77496914-77496936 CTGTCTCTGAAGATGGAGAAAGG - Intergenic
1010744033 6:79540865-79540887 TTGACTGTGGGGATGGAGGTAGG + Intergenic
1010865581 6:80973424-80973446 CTGTCTATGAAGATGAAGGAAGG - Intergenic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1011204326 6:84875342-84875364 TTGCCTGTGAAAATGGAAAAAGG + Intergenic
1011555968 6:88571859-88571881 ATGTATGTGAAGATGATGGAAGG + Intergenic
1011820936 6:91253418-91253440 TTAGCTTTGAAGATGGAGGAAGG - Intergenic
1011927764 6:92669169-92669191 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1012084355 6:94805158-94805180 GTGATTTTGAAGATGGAGGAAGG - Intergenic
1012165730 6:95948871-95948893 TTGACTGTGAAGACTGTGGAGGG + Intergenic
1012586433 6:100928594-100928616 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1012760795 6:103298023-103298045 TGAGCTTTGAAGATGGAGGAAGG - Intergenic
1012833828 6:104240178-104240200 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
1012957638 6:105588352-105588374 TTCTCTGTGAAGAGTCAGGAAGG - Intergenic
1013526249 6:110976533-110976555 CTGGCTTTGAATATGGAGGAAGG - Intergenic
1013622279 6:111901468-111901490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1013993605 6:116281203-116281225 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1014168079 6:118248552-118248574 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1014206608 6:118662798-118662820 TTGTCTCTGTAGAGGGAGGGAGG + Intronic
1014451983 6:121592399-121592421 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1014550331 6:122782783-122782805 GTTTCTGTGGAGATGGAGGTGGG + Intronic
1015070370 6:129086943-129086965 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1015279930 6:131422147-131422169 GTGGCAGTGAAGATGGAGGGAGG + Intergenic
1015374905 6:132499457-132499479 TTGCAAGTGTAGATGGAGGAAGG - Intronic
1015868093 6:137748073-137748095 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016341322 6:143064350-143064372 CTGGGTTTGAAGATGGAGGATGG + Intronic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1016488151 6:144566220-144566242 TTGTCAGTGAAGTTGGAGGTAGG + Intronic
1017056042 6:150436340-150436362 TGCTCTGTGAAGGAGGAGGAAGG + Intergenic
1017902775 6:158732624-158732646 TGGTCTTGGAAGATGGAGGCTGG - Intronic
1018176141 6:161180986-161181008 CTATCTGTAAAGATGGAGGAGGG + Intronic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018492425 6:164307694-164307716 TTGTCTGGGGAGAGAGAGGAGGG + Intergenic
1018637700 6:165878816-165878838 TAGCCTTTGAAGATGGAGGAAGG + Intronic
1019581467 7:1765647-1765669 TGGGCTCTGAAGATGGAGGAAGG + Intergenic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019739827 7:2667112-2667134 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1019844159 7:3480237-3480259 CTGGCTGTGAAGATGGAAGGGGG + Intronic
1020146798 7:5650647-5650669 CTGGCTTTGAAGATGGATGAAGG - Intronic
1020244589 7:6420866-6420888 TTCTCTGTGCAGATGGCAGATGG - Intronic
1020367954 7:7400393-7400415 TTGGCTTTGAAGATGGAAGAAGG + Intronic
1020408863 7:7867995-7868017 TTCTCTGTGAAGTAGGAGGCTGG + Intronic
1021149681 7:17134414-17134436 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1021209016 7:17821822-17821844 ATGGATGTGAATATGGAGGATGG - Intronic
1021476395 7:21066539-21066561 TTGGCTTTGAAGATGGAGGCAGG - Intergenic
1021688564 7:23211041-23211063 TTCTCTGTGAAGCAGGAGGTGGG - Intergenic
1021787713 7:24169021-24169043 CTGGCTTTGAAGATGGAGGAGGG - Intergenic
1021881042 7:25095794-25095816 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1021926575 7:25539851-25539873 TTCTTTGTGAAGGTGGAGGTGGG + Intergenic
1022513508 7:30959610-30959632 TTGTAAGAGAAGATGAAGGATGG + Intronic
1022828225 7:34038313-34038335 ATAGCTTTGAAGATGGAGGAGGG + Intronic
1022982317 7:35615759-35615781 TTGTATGTGAGGATGGAGGAGGG - Intergenic
1023030658 7:36087982-36088004 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023368229 7:39486534-39486556 TTGTCTTTGTACATGAAGGATGG - Intronic
1023686337 7:42739280-42739302 TTGGCTTTGATGATGGAGGAAGG - Intergenic
1023738934 7:43260663-43260685 GTATCTGTGAAGATGGAGAGAGG + Intronic
1023981248 7:45071731-45071753 CTGGCTGTGAAGACAGAGGAAGG - Intronic
1023994687 7:45152045-45152067 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1024287654 7:47773158-47773180 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1026132194 7:67629936-67629958 TTGTATGGGAGGAGGGAGGAAGG - Intergenic
1026654934 7:72248451-72248473 CTGACTTTGAAGATGGTGGAAGG - Intronic
1026920384 7:74151212-74151234 TTTTCTGTAGAGATGGGGGATGG - Intergenic
1027150327 7:75728916-75728938 TTGTCAGTGAAGGGGGAGTATGG + Intronic
1027203863 7:76081497-76081519 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
1027215961 7:76184129-76184151 CTAGCTCTGAAGATGGAGGAGGG + Intergenic
1027428835 7:78088991-78089013 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1028150624 7:87367288-87367310 ATGGCTTTGAAGATGGAAGAAGG + Intronic
1028204215 7:87997651-87997673 TTGCCTTTGAAAGTGGAGGAAGG - Intronic
1028208274 7:88041727-88041749 TTATCTGGGAAGACAGAGGAAGG - Intronic
1028583934 7:92434696-92434718 TTGTCTTTGAAGATGGAAGAAGG + Intergenic
1028843658 7:95455383-95455405 CTGGCTTTGAAGATGGACGAAGG - Intergenic
1028848795 7:95513106-95513128 TTAGCTTTGAAGATGGAGGAAGG + Intronic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029204088 7:98858535-98858557 TTGTCTCTAAAAATGGAGGGCGG + Intronic
1030254449 7:107492637-107492659 TTGGCTTTGAAGATGAAAGAAGG - Intronic
1030360534 7:108590628-108590650 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1030405183 7:109101512-109101534 ATGACTTTGAAGATGCAGGAAGG + Intergenic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1031132072 7:117844116-117844138 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1031554117 7:123150526-123150548 TTGGCTGTGAAAATGGAGTTAGG - Intronic
1031647829 7:124248602-124248624 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1031759830 7:125698818-125698840 TAGGCTTTGAAGATAGAGGAAGG - Intergenic
1031915440 7:127558756-127558778 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032050289 7:128645104-128645126 TTGGCTTTGAAGATGGAGTCAGG + Intergenic
1032534813 7:132653968-132653990 CTGCCTGAGAAGATGGTGGAAGG + Intronic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1032966278 7:137102246-137102268 CTGCCTGTGAAGGTGGAAGAAGG + Intergenic
1033436795 7:141340126-141340148 TTGGCTTTGAATATGGAGGAAGG + Intronic
1033616041 7:143015089-143015111 CTGTCTGGGAAAAGGGAGGAAGG + Intergenic
1033619296 7:143048131-143048153 CTGGCTTTGAAGATGGACGAGGG + Intergenic
1033637140 7:143222604-143222626 TTCTCCGTGGAGTTGGAGGAGGG - Exonic
1033858922 7:145600369-145600391 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1034113382 7:148560241-148560263 TTGGCTTTGAAGATGGGTGAAGG - Intergenic
1034381630 7:150700955-150700977 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035476759 7:159149344-159149366 TGGTCTGAGAAATTGGAGGATGG - Intergenic
1035846263 8:2868168-2868190 TTGTCTGTTGAGAATGAGGATGG - Intergenic
1036189833 8:6660300-6660322 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1036625296 8:10466114-10466136 TTGACTTTGAAGATGGAGGAAGG + Intergenic
1036777486 8:11623620-11623642 ATGTCTGTGATGATGGAGGCAGG - Intergenic
1037032312 8:14123968-14123990 TTAACTTTGAAGATAGAGGAAGG + Intronic
1037443883 8:18945386-18945408 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1037587932 8:20290804-20290826 TTGGCTTTGAAGCAGGAGGAAGG + Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038176872 8:25188184-25188206 TTGTTTGGTTAGATGGAGGAAGG + Intronic
1038197264 8:25379814-25379836 TTGTTTGTGGAGATGGAAAAAGG - Intronic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1038519938 8:28222608-28222630 TTGTCTGTGACTATGGTGAATGG + Intergenic
1038525674 8:28271077-28271099 TTGTCTCTAGAGAGGGAGGAAGG - Intergenic
1038683671 8:29694958-29694980 GTGTCAGTGATGATGGAGAAAGG - Intergenic
1039077429 8:33704423-33704445 CTGGCTTTGAAGATGGAGGGAGG + Intergenic
1039256161 8:35721212-35721234 AGGTGTGTGAAAATGGAGGATGG - Intronic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040603737 8:48909840-48909862 TAATCTCTGAAGATGGAGGGGGG + Intergenic
1040622040 8:49102012-49102034 TGGTCTTGGAAGATGGAGGCTGG - Intergenic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1040902735 8:52433564-52433586 TGTGCTTTGAAGATGGAGGAGGG - Intronic
1040979450 8:53230797-53230819 TTGTCTGTGAGGAAGGACCAGGG - Intronic
1041337339 8:56801100-56801122 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041396003 8:57391867-57391889 CTGACTTTGAAAATGGAGGAAGG + Intergenic
1041419827 8:57654056-57654078 TTTTCTGAGACGATGGAGGAGGG - Intergenic
1041674685 8:60526354-60526376 TTGGTTGTGAAGATGGAGGAAGG - Intronic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042216717 8:66435447-66435469 CCAGCTGTGAAGATGGAGGAAGG - Intronic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042518179 8:69681767-69681789 GAGTCTGTGAAGATGGGTGATGG - Intronic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1042773299 8:72402225-72402247 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1042985658 8:74580279-74580301 CTGGCTCTGAAGATGGAGGGGGG - Intergenic
1044000105 8:86868989-86869011 CTGGCTTTGAAGATGGAGGGGGG + Intronic
1044261506 8:90129266-90129288 TAGTCTCTGAAGATGAAGCAAGG - Intergenic
1044328027 8:90882756-90882778 TTGTCTGTAAAGAGAGAGAAGGG + Intronic
1044341765 8:91054259-91054281 TTGGCTTTGAAGATGGAGGAGGG - Intergenic
1044398657 8:91743996-91744018 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1044802863 8:95975061-95975083 CTGCCTTTGGAGATGGAGGAGGG + Intergenic
1044875218 8:96658746-96658768 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1044879442 8:96708097-96708119 ATGGCTTGGAAGATGGAGGAAGG - Intronic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1045400445 8:101811315-101811337 TTGGCTAGGAAGATGGAGGAAGG + Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1045607923 8:103799001-103799023 TTGAGTTTGAAGATGGGGGAAGG + Intronic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046711549 8:117516972-117516994 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1046929402 8:119827359-119827381 ATGTCTGTGCAGATAAAGGATGG - Intronic
1047298535 8:123592344-123592366 TTGTTTGTCAAACTGGAGGAGGG + Intergenic
1047444903 8:124910891-124910913 TGGTCTTGGAAGATGGAGGCTGG - Intergenic
1047509211 8:125503520-125503542 TTGGCTTTGAAGACGGAGGAAGG + Intergenic
1047748910 8:127865553-127865575 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1047766039 8:127990846-127990868 GTGTCTGTGAGGATGGTGGAGGG + Intergenic
1048034069 8:130660427-130660449 TAGTCTGTGAAGAAGAAGGTAGG + Intergenic
1048120770 8:131579086-131579108 GTGACTGTTAAGAAGGAGGATGG + Intergenic
1048323576 8:133421467-133421489 TTGACTTTGAGGATGGAGGAAGG + Intergenic
1048445728 8:134491631-134491653 TTGGCTTTGAAGATGGAAGCAGG - Intronic
1048489628 8:134880609-134880631 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1048894143 8:138974168-138974190 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1048984091 8:139722290-139722312 TTGGCTTTGAGGATGGAGGAAGG - Intergenic
1049452808 8:142671283-142671305 TGTGCTTTGAAGATGGAGGAAGG + Intronic
1049632661 8:143666978-143667000 ATGTATGTGCACATGGAGGAAGG - Intergenic
1049663858 8:143834270-143834292 CTAGCTCTGAAGATGGAGGAGGG + Exonic
1049772366 8:144389389-144389411 CTGTCTGTGAAGGTAAAGGATGG - Intronic
1049976321 9:863443-863465 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1050125536 9:2353021-2353043 TGCACTATGAAGATGGAGGAAGG - Intergenic
1050515394 9:6438219-6438241 ATATCTCTGAAGATGGAGAATGG + Intronic
1050628946 9:7538555-7538577 TTGAGAGTGAAGATGGAGGCAGG + Intergenic
1050768322 9:9164270-9164292 CTGACTTTGAAGATAGAGGAAGG - Intronic
1050931113 9:11327990-11328012 ATGGCTTTGAAGATGGAAGAAGG - Intergenic
1050962250 9:11749559-11749581 CCGACTTTGAAGATGGAGGAAGG - Intergenic
1051097863 9:13487185-13487207 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1051330895 9:16024051-16024073 TGCACTTTGAAGATGGAGGAAGG + Intronic
1051423245 9:16909584-16909606 GTGTTTGTGGGGATGGAGGAAGG + Intergenic
1051493710 9:17695814-17695836 ATGTCTCTGAAATTGGAGGATGG + Intronic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1051708253 9:19903263-19903285 CTGTCTGTGAACTAGGAGGAGGG - Intergenic
1051880455 9:21834581-21834603 CTGGCTCTGAAGATGGATGAGGG - Intronic
1051925823 9:22323559-22323581 CTGCCTTTGAAGGTGGAGGAAGG - Intergenic
1051972761 9:22910950-22910972 TTGGCTTTGAAGGTGGAGAAAGG + Intergenic
1051975080 9:22939308-22939330 CTGACTCTGAAGATGGAGAAAGG + Intergenic
1052016930 9:23479612-23479634 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1052290317 9:26832962-26832984 TCTTCTGTGAAGATGGTGAATGG - Intergenic
1052312209 9:27079770-27079792 TGCTCTTTGAAGATGGAGAAAGG + Intergenic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1053294998 9:36906401-36906423 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053654045 9:40197552-40197574 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053904433 9:42826729-42826751 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054366160 9:64343768-64343790 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054530552 9:66178785-66178807 GTGTTTGGGTAGATGGAGGAGGG - Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1054673789 9:67833498-67833520 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054824461 9:69558731-69558753 GGGTCTGTGAGGGTGGAGGATGG - Intronic
1054927253 9:70601458-70601480 CTGACTGTGAAGAGGCAGGAAGG + Intronic
1054960348 9:70961186-70961208 TGTGCTTTGAAGATGGAGGAAGG + Intronic
1054990187 9:71316588-71316610 CTGTCTTTGAAGATGGAAGGAGG + Intronic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1055110115 9:72551055-72551077 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1055363773 9:75522972-75522994 TTGGCTTTGAAGATGCAGGAAGG + Intergenic
1055427046 9:76207020-76207042 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1055567964 9:77587981-77588003 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1055795190 9:79968214-79968236 ATCGCTTTGAAGATGGAGGAAGG - Intergenic
1056118143 9:83461247-83461269 CTGGCTTTGAAGATGGAGGCAGG + Intronic
1056485530 9:87053322-87053344 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1056492379 9:87120307-87120329 TTCTCTATGAAGAAGCAGGAGGG + Intergenic
1056741357 9:89258064-89258086 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1056806416 9:89732415-89732437 TTTACTGTGCAGGTGGAGGAAGG + Intergenic
1057108844 9:92447757-92447779 TTGTCCGTAGAGATGCAGGAAGG + Intronic
1057379594 9:94555783-94555805 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1057533318 9:95874658-95874680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1057804141 9:98208737-98208759 TTGTCGGGGAAGCTGGAGGTGGG + Exonic
1057858770 9:98623636-98623658 CTGGCTTTGAAAATGGAGGAAGG - Intronic
1058441992 9:105017920-105017942 TGTGCTTTGAAGATGGAGGAAGG - Intergenic
1058666209 9:107318316-107318338 TTGCCTTTGAAGATGCAGAAAGG - Intronic
1058929809 9:109707994-109708016 GTGTCAGTGAAAATGGAGAAGGG - Intronic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1058978851 9:110150439-110150461 CTGGCCTTGAAGATGGAGGAAGG - Intronic
1059048800 9:110900276-110900298 TTGGCTTTGAAGAAAGAGGAAGG - Intronic
1059084455 9:111285000-111285022 TTTCTTGTGAAGATGGGGGAAGG - Intergenic
1059152613 9:111963153-111963175 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1059462575 9:114443443-114443465 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1059476503 9:114551849-114551871 TTGTAGGTGAAGATGGAGAATGG - Intergenic
1059752663 9:117262876-117262898 TTGGCTTTGCAGATGGAGGAAGG + Intronic
1059881109 9:118689930-118689952 TTGGCTTTGAAGATAGAAGAAGG - Intergenic
1059991360 9:119869266-119869288 TTCTCAGTCAAGATTGAGGATGG - Intergenic
1060046252 9:120343625-120343647 CTGGCTCTGAAGATGGAAGAAGG - Intergenic
1060112645 9:120917703-120917725 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1060293115 9:122322693-122322715 TCTTCTGTGTAGATGGGGGAGGG - Exonic
1060347129 9:122827306-122827328 TTGTCTGGGAAGTTGAAGGCTGG - Intronic
1060743548 9:126114774-126114796 TTCTCTGTGACGAAGGAGGAAGG - Intergenic
1060828113 9:126697805-126697827 TTTTCTGTGTATATGCAGGATGG + Exonic
1061020031 9:128008377-128008399 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1061292493 9:129659312-129659334 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1061415974 9:130447002-130447024 TTGTCTTTGGTGATGGACGAAGG - Intronic
1061444396 9:130629672-130629694 TTGACTGTGGGCATGGAGGAGGG + Intronic
1061819825 9:133220910-133220932 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1061916051 9:133754828-133754850 CTGGCTTTGAAGATGGAGCATGG + Intergenic
1062173974 9:135150794-135150816 TCAGCTTTGAAGATGGAGGAGGG - Intergenic
1062240830 9:135537038-135537060 CTGGCTTTGAAGGTGGAGGAGGG - Intergenic
1062529013 9:136991898-136991920 TTGTGTGTGAAGACGATGGAAGG + Intergenic
1203563523 Un_KI270744v1:75887-75909 TTGTCAGTGGCGATGGAGAAGGG - Intergenic
1185540167 X:897020-897042 CTGGCTTCGAAGATGGAGGAAGG - Intergenic
1186052616 X:5614938-5614960 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186331840 X:8542702-8542724 TTGACTTTGAAGCTGGTGGAAGG - Intronic
1186389088 X:9140522-9140544 TTGACTGTGGAGGTGGTGGAAGG - Intronic
1186421050 X:9426761-9426783 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186442532 X:9598593-9598615 TGGTCAGTGAAGAAAGAGGAAGG + Intronic
1186557416 X:10574279-10574301 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1186584756 X:10860994-10861016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186611539 X:11142720-11142742 TTGGCTTAAAAGATGGAGGAAGG + Intronic
1186624976 X:11283729-11283751 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1186633442 X:11376431-11376453 TTGACTTTCAAGATGGAAGAAGG + Intronic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1186656569 X:11618095-11618117 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1186689977 X:11964943-11964965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1186938441 X:14476896-14476918 TTGGCTGTGAAGAAAGAGGAAGG + Intergenic
1187123595 X:16432919-16432941 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1187146807 X:16644596-16644618 CTGGCTTTGAAGATGGAGGATGG + Intronic
1187504077 X:19864540-19864562 GTGGCTTTGAAGATGGAGGAAGG + Intronic
1187691761 X:21875801-21875823 TTGACTGAGAAGATGAAGGCAGG + Intronic
1188117962 X:26268261-26268283 GTGGCTTTGAAAATGGAGGAAGG - Intergenic
1188299224 X:28487058-28487080 CTGGCTTTGAAGATGGATGAAGG - Intergenic
1188434466 X:30145150-30145172 CTGACTTTGAAGACGGAGGAAGG + Intergenic
1188510818 X:30934583-30934605 CTGGCTTTGAAGCTGGAGGAAGG - Intronic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1188746429 X:33850445-33850467 CTGTCTTTGAAGATGAAGAAAGG + Intergenic
1188888920 X:35585333-35585355 TTTTCTGTGATGATGAAGGTGGG - Intergenic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189161552 X:38814214-38814236 CTGGCTGTGAAGATGGAAGAAGG + Intergenic
1189378079 X:40481213-40481235 ATTTGTGGGAAGATGGAGGAAGG - Intergenic
1189540175 X:41979193-41979215 TTTTCTGGGAAGGTCGAGGAGGG + Intergenic
1189722298 X:43932863-43932885 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1189730139 X:44011613-44011635 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1189917275 X:45868261-45868283 CTGACTGTGAAGATGGAGAAAGG + Intergenic
1189958573 X:46303173-46303195 TTGGCTTTGAGGCTGGAGGAAGG + Intergenic
1190118603 X:47642016-47642038 TTGGCTTTGAAGATGGAGGAAGG + Intronic
1190166088 X:48073979-48074001 TCAGCTTTGAAGATGGAGGAAGG - Intergenic
1190250805 X:48723703-48723725 TCCGCTGTGAAGATGGAGAAAGG - Intergenic
1190374598 X:49776486-49776508 TGGTTTGTGCTGATGGAGGAAGG + Intergenic
1190516998 X:51234167-51234189 TTGGCTTTGAATATAGAGGAAGG + Intergenic
1190576380 X:51843462-51843484 ATGGCTTTGAAGATGGAGGAAGG + Intronic
1190577208 X:51852145-51852167 TTATGTCTGAAGATGGAGAAAGG - Intronic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1191801942 X:65091243-65091265 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1191882644 X:65857937-65857959 TTGCCTCTGAAGATGAAGGAAGG - Intergenic
1191901491 X:66045337-66045359 CTAACTTTGAAGATGGAGGAAGG + Intergenic
1191936695 X:66434633-66434655 ATGACTGAGAAGGTGGAGGAGGG + Intergenic
1192341357 X:70266242-70266264 CTGGCTTTGAAGACGGAGGAAGG - Intergenic
1192531276 X:71888850-71888872 TTGGCTTTGAAGAAGGAGGAAGG + Intergenic
1193824161 X:86202219-86202241 TTATATGGGAGGATGGAGGAGGG + Intronic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1194129230 X:90059611-90059633 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1194454978 X:94092454-94092476 ATAGCTTTGAAGATGGAGGAAGG + Intergenic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1195129003 X:101836796-101836818 TTGTCTCTGAAGTGGAAGGATGG - Intronic
1195376752 X:104235073-104235095 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1195494196 X:105510721-105510743 CTGACTTTGAAGATGGTGGAAGG + Intronic
1195863944 X:109409470-109409492 TTGGCTTTGAAGATGGGGGAAGG + Intronic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1197135483 X:123055002-123055024 TTGTCTATGAGGATGGATGTTGG + Intergenic
1197333487 X:125182179-125182201 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197498013 X:127209610-127209632 CTGTCTTTGAAGATGAAGGAAGG - Intergenic
1197610896 X:128637063-128637085 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197845486 X:130797604-130797626 TTGCCTGAGATGATGGGGGAAGG + Intronic
1197853970 X:130895003-130895025 TGTTCTGGGAATATGGAGGAGGG - Intronic
1198377341 X:136052871-136052893 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1198431219 X:136568049-136568071 CTGGCTTTGAAGATGGAGGCCGG - Intergenic
1198440625 X:136659792-136659814 TTATCAGTGAAGATGCAGAAGGG + Exonic
1198699718 X:139383481-139383503 TTGTATGTGTAGATGGGGGTGGG + Intergenic
1198945076 X:142002617-142002639 TTGACTGTAAAGATTGTGGAAGG - Intergenic
1198952455 X:142087131-142087153 TTGGCGTTGAAGATGGAGGAGGG - Intergenic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1199030793 X:142996814-142996836 ATGTCTATAAAGATAGAGGAGGG + Intergenic
1199046744 X:143183066-143183088 TGATCTGGGAAGATGGAGCAGGG - Intergenic
1199318908 X:146415099-146415121 CTGTCTTTGAAGATAGAAGAAGG + Intergenic
1199424783 X:147688518-147688540 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1199539843 X:148946744-148946766 TGGTGTTTGAAGATGGACGAAGG - Intronic
1199611635 X:149621750-149621772 TTGACTTTGAAGATGGAGGAAGG - Intronic
1199681612 X:150228489-150228511 TGTGCTTTGAAGATGGAGGAGGG - Intergenic
1199691083 X:150309468-150309490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1199735321 X:150680672-150680694 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1199759045 X:150891403-150891425 CTGGCTTTGAAGATGGAGCAAGG - Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199923208 X:152431790-152431812 CTGACTTTGAAGATGGGGGAAGG + Intronic
1200291330 X:154877406-154877428 CTGGCTTCGAAGATGGAGGAAGG + Intronic
1201159913 Y:11158607-11158629 TTGTCAGTGGCGATGGAGAAGGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201430774 Y:13899916-13899938 TTGACTTTGAAGCTGGTGGAAGG + Intergenic